View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10676_low_6 (Length: 218)
Name: NF10676_low_6
Description: NF10676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10676_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 14 - 203
Target Start/End: Complemental strand, 55694916 - 55694728
Alignment:
| Q |
14 |
agggaacatgatcaaatcatacttcataattcatatgtcttatcttcaaataacttgatagatatttttgattgaagttctgctttaaataacaataata |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| | ||| || |||| |
|
|
| T |
55694916 |
agggaacatgatcaaaacatacttcataattcatatgtcttatattcaaataacttgatagatatttttgattgaagtgctgcttctagtaataaaaata |
55694817 |
T |
|
| Q |
114 |
caatgtagtagaatcaattaannnnnnnaagagcaaattgattattgatcttttttggattatgaaaaataaacacagggaaagagatct |
203 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55694816 |
caatgtagtagaatcaatt-attttttcaagagcaaattgattattgatcttttttggattatgaaaaataaacacagggaaagagatct |
55694728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University