View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10678_high_14 (Length: 227)
Name: NF10678_high_14
Description: NF10678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10678_high_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 26935810 - 26936036
Alignment:
| Q |
1 |
tactgaacacaggaaatcttgtgcttgtggatgaattcaacaatatcaaatggcaaagtttcaattttccaactgatgtaatgctatggggccagcaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26935810 |
tactgaacacaggaaatcttgtgcttgtggatgaattcaacaatatcaaatggcaaagtttcaattttccaactgatgtaatgctatggggccagcaact |
26935909 |
T |
 |
| Q |
101 |
tgatgtagcgactcgattaacatcgtcgcgaaccaactcaagcatgttctactcattcgaaatcgagaataacaaggttgctttgtatgtaaactctggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26935910 |
tgatgtagcgactcgattaacatcgtcgcgaaccaactcaagcatgttctactcattcgaaatcgagaataacaaggttgctttgtatgtaaactctggt |
26936009 |
T |
 |
| Q |
201 |
gagttaaggtattcttattggaacttt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
26936010 |
gagttaaggtattcttattggaacttt |
26936036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University