View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10678_low_12 (Length: 371)
Name: NF10678_low_12
Description: NF10678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10678_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 18 - 353
Target Start/End: Complemental strand, 4957494 - 4957159
Alignment:
| Q |
18 |
aaattgctgatggtaaagcatttcatcatttcattaaattttggtcttcactttcaaaaggaaacttagaatgttcttctctttcattaccattacacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4957494 |
aaattgctgatggtaaagcatttcatcatttcattaaattttggtcttcactttcaaaaggaaacttagaatgttcttttctttcattaccattacacaa |
4957395 |
T |
|
| Q |
118 |
aagggaaatcattcaagatccaaaaaaccttaaacaaagcaccttagaacaattatggaattatccaccaaaatcattagaatctactacctctacaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4957394 |
aagggaaatcattcaagatccaaaaaaccttaaacaaagcatcttagaacaactatggaatcatccaccaaaatcattagaatctactacctctacaaat |
4957295 |
T |
|
| Q |
218 |
gatcatgctgcttctagaaacaacatggttcgttatagatttaatttgacacgtcaccaagttgaaaatttaaagaaatgggtttttacaaaatgtcaaa |
317 |
Q |
| |
|
|| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
4957294 |
gaccatgctgcttctagaaacaacattgttcgttatagatttaatttaacacgtcaccaagttgaaaatttgaagaaatgggttgttacaaaatgtcaaa |
4957195 |
T |
|
| Q |
318 |
atattggtcttgaaacatttcatttgtcaacctttg |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4957194 |
atattggtcttgaaacatttcatttgtcaacctttg |
4957159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University