View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10678_low_19 (Length: 302)
Name: NF10678_low_19
Description: NF10678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10678_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 19 - 284
Target Start/End: Original strand, 5663121 - 5663386
Alignment:
| Q |
19 |
catagagatagattgaatacaaatttccaacaaaggagtttaactttatcatagaaggtaaaacagatctccatggagaagcctattaggctatgtgaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5663121 |
catagagatagattgaatacaaatttccaacaaaggagtttaactttatcatagaaggtaaaacagatctccatggagaagcctattaggctatgtgaaa |
5663220 |
T |
|
| Q |
119 |
aagagtacacgaggatggccatgcaaaaacatgaagaagatgcggttgaaattaccactgcagatatctctaggaattttatattgcagccgcaattgca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5663221 |
aagagtacacgaggatggccatgcaaaaacatgaagaagatgcggttgaaattaccactgcagatacctctaggaattttatattgcagccgcaattgca |
5663320 |
T |
|
| Q |
219 |
tttgcagactacaatttaattgtattatctaagtattctgacnnnnnnnttataggtatacgaact |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5663321 |
tttgcagactacaatttaattgtattatctaagtattctgacaaaaaaattataggtatacgaact |
5663386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University