View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10678_low_21 (Length: 286)
Name: NF10678_low_21
Description: NF10678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10678_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 19 - 276
Target Start/End: Original strand, 45280702 - 45280957
Alignment:
| Q |
19 |
aaaatggcagaacagaacacttattcatcatgatgaaaaaatggcatatacagaccaatctccacaaatggtgtgtggtatactacatcttttggatcta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45280702 |
aaaatggcagaacagaacacttattcatcatgatgaaaaaatggcatatacagaccaatttccacaaatggtgtgtggtatactacatcttttggatcta |
45280801 |
T |
|
| Q |
119 |
gggcgattgttaggtaacctttaatgatttaatgtgatgtacttatggttagttgtataacttgccttaaatttaaagcaatatatatggttaaaaacta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45280802 |
gggcgattgttaggtaacctttaatgatttaatgtgatgtacttatggttagttgtataacttgccttaaatttaaagca--atatatggttaaaaacta |
45280899 |
T |
|
| Q |
219 |
ttgaaaaaatggtgatgtttcaaattcaatcactacgtaatgcgagatctgatctgtg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45280900 |
ttgaaaaaatggtgatgtttcaaattcaatcactacgtaatgcgagatctgatctgtg |
45280957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University