View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10678_low_22 (Length: 286)
Name: NF10678_low_22
Description: NF10678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10678_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 275
Target Start/End: Complemental strand, 40303312 - 40303058
Alignment:
| Q |
19 |
caagtagcatcacatctctgattttttcctttgcccctatttttcatatgcttctttaggaaacttaataggttgtagaatgtgaatattggacaaacag |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40303312 |
caagtagcatcacatctctgattttgtcctttgcccctatttttcatatgcttctttaggaaacttaataggttgtagaatgtgaacattggacaaacag |
40303213 |
T |
|
| Q |
119 |
taatttgtattattgatgaaccaaacaaattacattggtagaagnnnnnnnngttctgatagcaacgagtctactagcccttttctctttgtcccactat |
218 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40303212 |
taatgtgtactattgatgaaccaaacaaattacattggtagaagaaaaaaaagttctgatagtaacgagtctactagcccttt--tctttgtcccactat |
40303115 |
T |
|
| Q |
219 |
aacagacttcatcataacctccaatttctcactctttataactaacttacgcttcat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40303114 |
aacagacttcatcataacctccaatttctcactctttataactaacttacgcttcat |
40303058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University