View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10678_low_23 (Length: 281)
Name: NF10678_low_23
Description: NF10678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10678_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 15 - 267
Target Start/End: Complemental strand, 28551112 - 28550860
Alignment:
| Q |
15 |
acctgtgaaaagagatcatgtcttatgtgcaagaatgagtctacgaacgatccaacaagacaaccatctgggatcttagaggaaattcgcaattggcgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28551112 |
acctgtgaaaagagatcatgtcttatgtgcaagaatgagtctacgaacgatccaacaagacaaccatctgggatcttagaggaaattcgcaattggcgtg |
28551013 |
T |
|
| Q |
115 |
aagatgagatagagtctctagcacattaattcagttttattgaaatgtgtttaatatggcatgaaccttgtgatttttaaacatcaataatacttcactt |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28551012 |
aagatgagatagattctctagcacattaattcagttttattgaaatgtgtttaatatggcatgaaccttgtgatttttaaacatcaataatacttcactt |
28550913 |
T |
|
| Q |
215 |
tcctttttgttgggacggtgcatgtgcatggcttgcagttttctagtcttatg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550912 |
tcctttttgttgggacggtgcatgtgcatggcttgcagttttctagtcttatg |
28550860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University