View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10678_low_36 (Length: 214)
Name: NF10678_low_36
Description: NF10678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10678_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 23 - 199
Target Start/End: Original strand, 48067221 - 48067397
Alignment:
| Q |
23 |
ttggtgtgatctccattgtgttttgttgaatggttgtaaagagacactatcagtccataattccacacctggacttggattcttgctctgcattgctagt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48067221 |
ttggtgtgatctccattgtgttttgttgaatggttgtaaagagacactatcagtccataattccacacctggacttggattcttgctctgcattgctagt |
48067320 |
T |
|
| Q |
123 |
aaatttcagttgacaatatttaaaaaatatctaaatagataaatccaataacttccactattttatttcactctctg |
199 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48067321 |
aaatttcagttgacaatatttaacaaatatctaaatagataaatccaataacttccactattttatttcactctctg |
48067397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 133
Target Start/End: Original strand, 48100273 - 48100373
Alignment:
| Q |
27 |
tgtgatctccattgtgttttgttgaatggttgtaaagagacactatcagtccataattccacacctggacttggattcttgctctgcattgctagtaaat |
126 |
Q |
| |
|
||||||||||||||| | ||| ||||||||||||| ||||||||||||| ||||| |||||| | ||||||||| || ||||||||| | ||||| |
|
|
| T |
48100273 |
tgtgatctccattgtttcttggtgaatggttgtaaggagacactatcagcccatagttccac------agttggattctcgcactgcattgccaataaat |
48100366 |
T |
|
| Q |
127 |
ttcagtt |
133 |
Q |
| |
|
||||||| |
|
|
| T |
48100367 |
ttcagtt |
48100373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University