View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10679_high_9 (Length: 234)
Name: NF10679_high_9
Description: NF10679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10679_high_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 10 - 234
Target Start/End: Complemental strand, 5795885 - 5795660
Alignment:
| Q |
10 |
gcagagaacttgtgtagtatgaaggttatcttgagcaacatgtcctctactttcnnnnnnnggggggcatagagtgccattttattgggaagggtttgga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5795885 |
gcagagaacttgtgtagtatgaaggttatcttcagcaacatgtcctctactttctttttttggggggcatagagtgccattttattgggaagggtttgga |
5795786 |
T |
 |
| Q |
110 |
aaagctttgatccgttaaaagtcgttatcttt-cttagcaaatgcttcaacgttgtttacctacaagggagaatttgttgaggtgtggggcatttgagcc |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5795785 |
aaagctttgatccgttaaaagtcattatcttttcttagcaaatgcttcaacgctgtttacctacaagggagaatttgttgaggtgtggggcatttgagcc |
5795686 |
T |
 |
| Q |
209 |
gagaaatgaaccgaaatgttgctggt |
234 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
5795685 |
gggaaatgaaccgaaatgttgctggt |
5795660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University