View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10679_low_15 (Length: 241)

Name: NF10679_low_15
Description: NF10679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10679_low_15
NF10679_low_15
[»] chr8 (1 HSPs)
chr8 (1-132)||(44857287-44857418)
[»] chr1 (1 HSPs)
chr1 (2-67)||(37221722-37221787)


Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 44857287 - 44857418
Alignment:
1 acaaagatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagattttgtcacgagaatgtggtctgcatttgttgcatga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44857287 acaaagatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagattttgtcacgagaatgtggtctgcatttgttgcatga 44857386  T
101 aacagaaccatcttctagttcagtttcagaac 132  Q
    ||||||||||||||||||||||||||||||||    
44857387 aacagaaccatcttctagttcagtttcagaac 44857418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 2 - 67
Target Start/End: Original strand, 37221722 - 37221787
Alignment:
2 caaagatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagatttt 67  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37221722 caaagatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagatttt 37221787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University