View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10679_low_15 (Length: 241)
Name: NF10679_low_15
Description: NF10679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10679_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 44857287 - 44857418
Alignment:
| Q |
1 |
acaaagatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagattttgtcacgagaatgtggtctgcatttgttgcatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44857287 |
acaaagatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagattttgtcacgagaatgtggtctgcatttgttgcatga |
44857386 |
T |
 |
| Q |
101 |
aacagaaccatcttctagttcagtttcagaac |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44857387 |
aacagaaccatcttctagttcagtttcagaac |
44857418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 2 - 67
Target Start/End: Original strand, 37221722 - 37221787
Alignment:
| Q |
2 |
caaagatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagatttt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37221722 |
caaagatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagatttt |
37221787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University