View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10679_low_18 (Length: 240)
Name: NF10679_low_18
Description: NF10679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10679_low_18 |
 | |
|
| [»] scaffold0178 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0178 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 13106 - 12883
Alignment:
| Q |
1 |
tcatcctaaaaacctcatcatgcttcttttcaagctccaattgcaaccgattcgacacggtccctagtgttctcaacttactctgattctcttccacttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13106 |
tcatcctaaaaacctcatcatgcttcttttcaagctccaattgcaaccgattcgacacggtccctagtgttctcaacttactctgattctcttccacttc |
13007 |
T |
|
| Q |
101 |
agcttctaatgaagacccaaatggaaaagaggtgtacaaattagggttacagtaaaatttcttgaattctgataatctctgaagatgtgaaataagcact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13006 |
agcttctaatgaagacccaaatggaaaagaggtgtacaaattagggttacagtaaaatttcttgaattctgataatctctgaagatgtgaaataagcact |
12907 |
T |
|
| Q |
201 |
ttatcagtggttttcacgttttct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
12906 |
ttatcagtggttttcacgttttct |
12883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University