View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10679_low_22 (Length: 228)
Name: NF10679_low_22
Description: NF10679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10679_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 212
Target Start/End: Original strand, 45068776 - 45068968
Alignment:
| Q |
20 |
gagaatcatcaccatgaatgaggccaaaaccaattgcattgattgttcaaatcaatgcactggaagggaaaggggttactgtgtgtgtgaagtgccctta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45068776 |
gagaatcatcaccatgaatgaggccaaaaccaattgcattgattgttcaaatcaatgcactggaagggaaaggggttactgtgagtgtgaagtgccctta |
45068875 |
T |
 |
| Q |
120 |
tcggcaataccttagttcaaggaaggaatattgattttctgcttctcaatgtgacttctctttttcttacataatcatttaagtggccccttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45068876 |
tcggcaataccttagttcaaggaaggaatattgattttctgcttctcaatgtgacttctctttttcttacataatcatttaagtggccccttt |
45068968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University