View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10679_low_24 (Length: 227)
Name: NF10679_low_24
Description: NF10679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10679_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 35245352 - 35245474
Alignment:
| Q |
1 |
ataggaactgagaaaagagcatatgtagatataatagccaatataaaggttgaagttggagagatgacaatagtaactatatttagttggtaaagtaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35245352 |
ataggaactgagaaaagagcatatgtagatataatagccaatataaaggttgaagttggagagatgacaatagtaactatatttagttggtaaagtaata |
35245451 |
T |
 |
| Q |
101 |
aacaaatattttacagatattca |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35245452 |
aacaaatattttacagatattca |
35245474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 126 - 223
Target Start/End: Original strand, 35263910 - 35264004
Alignment:
| Q |
126 |
tagtgcatcttcaatgtgtgttgactgttcacgcatgtggctcagtaagcttctactcaggcctgatagtactgtaaggatgaagttaccctagccaa |
223 |
Q |
| |
|
||||||||||||||||||||| | ||| ||| |||||| | |||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35263910 |
tagtgcatcttcaatgtgtgtccagtgtccacacatgtgtcccagtaagcttctacataggcctgatag---tgtaaggatgaagttaccctagccaa |
35264004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 129 - 225
Target Start/End: Original strand, 35271330 - 35271423
Alignment:
| Q |
129 |
tgcatcttcaatgtgtgttgactgttcacgcatgtggctcagtaagcttctactcaggcctgatagtactgtaaggatgaagttaccctagccaatt |
225 |
Q |
| |
|
||||||||||||||| || | ||| ||| |||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35271330 |
tgcatcttcaatgtgagtccagtgtccacacatgtggcctagtaagcttctacataggcctgatagt---gtaaggatgaagttaccctagccaatt |
35271423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University