View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10679_low_26 (Length: 216)
Name: NF10679_low_26
Description: NF10679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10679_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 5795674 - 5795481
Alignment:
| Q |
1 |
cgaaatgttgctggttttcgagggtgaaggaaacggaagacaacctatttgcaaagtgtgagtttgcgaatgaaatttggtataagatttttcattggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5795674 |
cgaaatgttgctggttttcgagggtgaaggaaacggaagacaacccatttgcaaagtgtgagtttgcgaatgaaatttggtataagatttttcattggtt |
5795575 |
T |
|
| Q |
101 |
aggcgtatccatgatacggtttggggacctcttttgtcttgctagaaaattgttgtttatgtcttaggaaaaataagaaagtcaaggggttgct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5795574 |
aggcgtatccatgatacggtttggggacctcttttgtcttgctagaaaattgttgtttatgtcttaggaaaaataagaaagccaaggggttgct |
5795481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 13369995 - 13369935
Alignment:
| Q |
22 |
gggtgaaggaaacggaagacaacctatttgcaaagtgtgagtttgcgaatgaaatttggta |
82 |
Q |
| |
|
|||||||||||||||| ||| ||||||| |||| ||||||||||| | || ||||||||| |
|
|
| T |
13369995 |
gggtgaaggaaacggaggaccacctattcacaaaatgtgagtttgcaagtgcaatttggta |
13369935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University