View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10679_low_7 (Length: 300)
Name: NF10679_low_7
Description: NF10679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10679_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 295
Target Start/End: Original strand, 31405033 - 31405309
Alignment:
| Q |
20 |
actcgtgcctaaatatgggttcataaaaactcatcgacataaccactaaccaacgactttatattttcatattgttatgattaagtcttcgacattttca |
119 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31405033 |
actcgcgcttaaatatgggttcataaaaactcatcgacataaccactaaccaacgactttatattttcatattgttatgattaagtcttcaacattttca |
31405132 |
T |
 |
| Q |
120 |
attaatggaggtttgttatagtattttcatatgcttgagccattctttaaccatga-tannnnnnngttaaatgacaaatattagtatgttaggattttc |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
31405133 |
attaatggaagtttgttatagtattttcatatgcttgagccattctttaaccatgattttttttttgttgaatgacaaatattagtatgttaggattttc |
31405232 |
T |
 |
| Q |
219 |
atatgcctaatgagatatctttacccccattaaccggttatccaaccctggaaacttagatggtagttcatctctct |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31405233 |
atatgcctaatgagatatctttacccccattaaccggttatccaaccctggaaacttagatggtagttcatctctct |
31405309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University