View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10680_low_11 (Length: 216)
Name: NF10680_low_11
Description: NF10680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10680_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 45668174 - 45668349
Alignment:
| Q |
20 |
ttagtttcattcgaaagaacagaaaatagatatctctgctaatgcttgcttataacttgaactttcagtgactggttttattactcctttttcagtgttt |
119 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668174 |
ttagtttcattcaaaagaacagaaaatagatctctctgctaatgcttgcttataacttgaactttcagtgactggttttattactcctttttcagtgttt |
45668273 |
T |
|
| Q |
120 |
cttccctcagaatttgattgtcagtgttagaacaccactttttcttctcaatactgcttatgattcatggcaggta |
195 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668274 |
cttccctcagaatttgattgccagtgttagaacaccactttttcttctcaatactgcttatgattcatggcaggta |
45668349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University