View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10681_low_17 (Length: 238)
Name: NF10681_low_17
Description: NF10681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10681_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 5 - 223
Target Start/End: Original strand, 30315104 - 30315320
Alignment:
| Q |
5 |
aacaacgttacaagttattaaaagagtatataataataaataatactcgtaaaatgattgtaatgttggggattaacaatgaatattggactcacggaga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30315104 |
aacaacgttacaagttattaaaagagtatataataataaataatactcgtaaaatgattgtaatgttgaggattaacaatgaat--tggactcacggaga |
30315201 |
T |
|
| Q |
105 |
gtgtcattgactcgaaatctatgtgttcgagcccactgattgtagtcttcagaaggattcacgacccaaccatctttgccaccaacatgaaactcctttg |
204 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30315202 |
gtgtcattgactcgaaacctatgtgttcgagcccactgattgtagtcttcagaaggattcacgacccaaccatctttgccaccaacatgaaactcctttg |
30315301 |
T |
|
| Q |
205 |
cttcaagcaacattggtgt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30315302 |
cttcaagcaacattggtgt |
30315320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University