View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10681_low_21 (Length: 204)
Name: NF10681_low_21
Description: NF10681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10681_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 185
Target Start/End: Original strand, 41066375 - 41066540
Alignment:
| Q |
20 |
ccatgaaagtagagagagaccttcttggtttagagaagaaatgaatggaaacaaggagatagtgagaaacaagataagaaaatttaatgcattgtttgac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066375 |
ccatgaaagtagagagagaccttcttggtttagagaagaaatgaatggaaacaaggagatagtgagaaacaagataagaaaatttaatgcattgtttgac |
41066474 |
T |
|
| Q |
120 |
atgatgagttggttttctgctactgttctatctcatctaaaacatagcagcagtactattttttct |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41066475 |
atgatgagttggttttctgctactgttctatctcatctaaaacatagcagcagtactagtttttct |
41066540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University