View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10681_low_3 (Length: 347)
Name: NF10681_low_3
Description: NF10681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10681_low_3 |
 |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (3 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0276 (1 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0191 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |  |
|
| [»] scaffold0864 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 152)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 20 - 331
Target Start/End: Original strand, 13640931 - 13641240
Alignment:
| Q |
20 |
tacccaagagatccaagttcaattcaactaggaccaatgtaatgttggtacgaaacaacaattaacgttgcattacactttgaaaacgacaactaaatag |
119 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
13640931 |
tacccaagagatccaagtccaattcgactaggaccaatgtaatgttggtacgaaacaataattaaagttgcattaaactttgaaaacgacaactaaatag |
13641030 |
T |
 |
| Q |
120 |
gaatacaatgttctacaattgggacaattaaaagagacaggtgggagtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggt |
219 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||| | | | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13641031 |
gaatacaatattctacaattgggacaattaaaagagaaaggcccg--ttcccgtgagcatagctcagctggtagggatatcgcattttatatgcaggggc |
13641128 |
T |
 |
| Q |
220 |
cagggttcgaaccccgaattccccacttattcaccttacggttggacttctagtcactagactacttgagtattttctagttactttttatgcggctaag |
319 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13641129 |
cagggtttgaaccctaaattccccacttattcaccttacggttggacttctagccactagactacttgagtattttctagttactttttatgcggctaag |
13641228 |
T |
 |
| Q |
320 |
tctgatataaac |
331 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13641229 |
tctgatataaac |
13641240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 18360495 - 18360559
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||||||| ||||||||||||||||| | |||||||||||||| |
|
|
| T |
18360495 |
cgtgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccg |
18360559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 34353781 - 34353845
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
34353781 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagaggtcagggttcgaaccccg |
34353845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 166 - 257
Target Start/End: Original strand, 36008268 - 36008360
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||||| |||||||||||||||||| |
|
|
| T |
36008268 |
gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccgaacaccccacttattcacctta |
36008360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 36602434 - 36602370
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||||||| ||||||||||||||||| | |||||||||||||| |
|
|
| T |
36602434 |
cgtgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccg |
36602370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 179 - 230
Target Start/End: Complemental strand, 12775299 - 12775248
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12775299 |
tagctcagttggtagggatattgcattttatatgcaggggtcagggttcgaa |
12775248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 44602487 - 44602550
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||||||||||||| | ||||||||||||| |
|
|
| T |
44602487 |
cgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaacccc |
44602550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 39023177 - 39023239
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
39023177 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccc |
39023239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 43978010 - 43978072
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
43978010 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccc |
43978072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 171 - 236
Target Start/End: Original strand, 5165859 - 5165924
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccga |
236 |
Q |
| |
|
||||||| || ||||| ||||||||||||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
5165859 |
cgtgagcttaactcagttggtagggatatcgcatattatatgcaggggccggggttcgaaccccga |
5165924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 8690207 - 8690295
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||||||||||| ||| | ||| | ||||| ||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
8690207 |
gtcctcgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
8690295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 8965096 - 8965160
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
8965096 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
8965160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 9692955 - 9693043
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||||| ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
9692955 |
gtccccgtgagcatagctcagttggcagggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
9693043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 13578533 - 13578469
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13578533 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccg |
13578469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 15604108 - 15604044
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||| | |||||||||||||||||||| || ||||||||||| |
|
|
| T |
15604108 |
cgtgagcttagctcagttggtagggatgttgcattttatatgcaggggtcgggattcgaaccccg |
15604044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 174 - 234
Target Start/End: Complemental strand, 44312849 - 44312789
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||||||||||||||||| || |||||||||| |
|
|
| T |
44312849 |
gagcttagctcagttggtagggatattgcattttatatgcaggggtcgggattcgaacccc |
44312789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 47934140 - 47934076
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
47934140 |
cgtgagcttagctcagttggtagggatatggcatattatatgcaggggccggggttcgaaccccg |
47934076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 49901484 - 49901548
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
49901484 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
49901548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 50457782 - 50457718
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||| |||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
50457782 |
cgtgagcttagctcagttggtaaggatattgcatattatatgcaggggccagggttcgaaccccg |
50457718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 55049385 - 55049325
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55049385 |
cgtgaacatagctcagctggtaaggatatcgcattttatatgcagggggttgggttcgaac |
55049325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 35465437 - 35465496
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
||||||| |||||||| |||||||||||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
35465437 |
cgtgagcttagctcagttggtagggatattgcattttatatacaggggttagggttcgaa |
35465496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 166 - 256
Target Start/End: Original strand, 49319387 - 49319477
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||||||||||| ||| | ||| || ||||| ||||||||||||||| |||||| ||||||| | ||||||||||||||||| |
|
|
| T |
49319387 |
gtcctcgtgagcatagctcagttggcatggacat-gcattattatatgcaggggtcggggttccaaccccggacaccccacttattcacctt |
49319477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 7686330 - 7686268
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||| ||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
7686330 |
cgtgagcttagctcagttggtagagatattgcattttatatgcaggggccggggttcgaaccc |
7686268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 173 - 235
Target Start/End: Complemental strand, 10417287 - 10417225
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10417287 |
tgagcttagctcagttggtagggatattacatattatatgcaggagtcagggttcgaaccccg |
10417225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 183 - 237
Target Start/End: Complemental strand, 31308219 - 31308165
Alignment:
| Q |
183 |
tcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31308219 |
tcagttggtaggaatatcgcattttatatgcaggagttagggttcgaaccccgaa |
31308165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 253
Target Start/End: Complemental strand, 28520834 - 28520745
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
28520834 |
agtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
28520745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 170 - 235
Target Start/End: Complemental strand, 29771368 - 29771303
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
29771368 |
tcgtgagcttagctcaattggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
29771303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 637101 - 637165
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||||||||||| |||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
637101 |
cgtgagcttagctcagctggtaggaatattgcatattatatgcaggagccggggttcgaaccccg |
637165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 4958624 - 4958560
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||| |||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
4958624 |
cgtgagcttagttcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
4958560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 5305078 - 5305014
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| ||||||| ||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
5305078 |
cgtgagcttatctcagttggtaggaatatcgcattttatatgcaggggccgaggttcgaaccccg |
5305014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 6371116 - 6371180
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
6371116 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
6371180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 11375957 - 11375893
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
11375957 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccggggttcgaaccccg |
11375893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 12504715 - 12504647
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| || ||||| |||||||||||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
12504715 |
tcctcgtgagcttatctcagttggtagggatattgcatattatatgcaggagtcgaggttcgaaccccg |
12504647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 21935487 - 21935543
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
21935487 |
tagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
21935543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 22230502 - 22230438
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
22230502 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
22230438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 30057232 - 30057288
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||||| |||||| ||||||| |
|
|
| T |
30057232 |
tagctcagttggtagggatattgcatattatatgcaggggtcggggttcaaaccccg |
30057288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 173 - 253
Target Start/End: Complemental strand, 35888842 - 35888762
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||| || |||||| || |||| | ||||||||| || |||||||||||||||| ||||||||||||||| |
|
|
| T |
35888842 |
tgagcatagctcaattgatagggacattgcatgtaatatgcaggagttggggttcgaaccccgaactccccacttattcac |
35888762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 169 - 237
Target Start/End: Complemental strand, 39696407 - 39696340
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||| ||||||| ||| ||| |||||||||||||||| |
|
|
| T |
39696407 |
ctcgtgagcttagctcagttggtagggatattgcatattatatgtaggagtc-gggttcgaaccccgaa |
39696340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 43147452 - 43147388
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
43147452 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
43147388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 43596897 - 43596961
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
43596897 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
43596961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 46105537 - 46105601
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
46105537 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
46105601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 46775098 - 46775034
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
46775098 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
46775034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 166 - 257
Target Start/End: Original strand, 48512192 - 48512284
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| |||||||| |||||| | |||||||||||||||||| |
|
|
| T |
48512192 |
gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggctagggttcgtaccccggacaccccacttattcacctta |
48512284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 55021564 - 55021620
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||||||| |||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
55021564 |
tagctcagttggtaggaatattgcatattatatgcaggggtcggggttcgaaccccg |
55021620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 55251419 - 55251355
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
55251419 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
55251355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 55531264 - 55531320
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||| | |||||| ||||||| |
|
|
| T |
55531264 |
tagctcagttggtggggatatcgcattttatatgcaggggccggggttcaaaccccg |
55531320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 56088014 - 56087958
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||| | ||||||||| |||| |
|
|
| T |
56088014 |
tagctcagttggtagggatattgcattttatatgcaggggccggggttcgaatcccg |
56087958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 230
Target Start/End: Complemental strand, 39697930 - 39697871
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
39697930 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggggtcggggttcgaa |
39697871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 40051624 - 40051687
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| |||||| ||||||||||||| |
|
|
| T |
40051624 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggtaggggttcgaacccc |
40051687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 172 - 235
Target Start/End: Original strand, 46206580 - 46206643
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| ||||||||| || ||||| |||||||||||||| || ||||||||||| |
|
|
| T |
46206580 |
gtgagcttagctcagttggtagggacattgcattatatatgcaggggtcgggattcgaaccccg |
46206643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 47018042 - 47017956
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||||||||||||| | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
47018042 |
cgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
47017956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 48569244 - 48569181
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
48569244 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
48569181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 205 - 256
Target Start/End: Original strand, 56555581 - 56555632
Alignment:
| Q |
205 |
tttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||| ||||||||||||||||| |
|
|
| T |
56555581 |
tttatatgcaggggtcggggttcgaacctcgaacaccccacttattcacctt |
56555632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 256
Target Start/End: Original strand, 9924855 - 9924940
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||| |||| ||||||| | | |||||| ||||||||||||||| |||||||||||||| | | ||||||||||||||| |
|
|
| T |
9924855 |
cgtgagcatagttcagttggtagg-acaacgcattattatatgcaggggtcggggttcgaaccccggacactccacttattcacctt |
9924940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 29536120 - 29536174
Alignment:
| Q |
180 |
agctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
29536120 |
agctcagttggtagagatatcgcattttatatgcaggggccgaggttcgaacccc |
29536174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 37719002 - 37719068
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| || ||||| || |||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
37719002 |
cgtgagcttaactcagttgttagggatatcgcattttatatgcaggggtcgaagttcgaactccgaa |
37719068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 43481107 - 43481045
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| || ||||| |||||||||||| ||| |||||||||||||| | |||||||||||| |
|
|
| T |
43481107 |
cgtgagcttaactcagttggtagggatattgcactttatatgcaggggccggggttcgaaccc |
43481045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 49757352 - 49757290
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||||||||||||| ||||||| |||| |||| ||||||||||| | | |||||||||||| |
|
|
| T |
49757352 |
cgtgagcatagctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccc |
49757290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 55853176 - 55853110
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| |||||| ||||| |||| ||||||||||||| | | |||||||||||||| |
|
|
| T |
55853176 |
cgtgagcttagctcagttggtagagatattgcatattatatgcaggggccggtgttcgaaccccgaa |
55853110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 56360772 - 56360718
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||||| |||||||||||| || | ||||||| |||||||||||||||||||| |
|
|
| T |
56360772 |
tagctcagttggtagggatattgcgtattatatgtaggggtcagggttcgaaccc |
56360718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 235
Target Start/End: Complemental strand, 56479296 - 56479231
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| | || ||||| |||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
56479296 |
ctcgtgaacttaactcagttggtagggatattgcatattatatgcaggggtc-gggttcgaaccccg |
56479231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 27743776 - 27743727
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtc |
220 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| |
|
|
| T |
27743776 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggggtc |
27743727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 213 - 254
Target Start/End: Original strand, 30696764 - 30696805
Alignment:
| Q |
213 |
caggggtcagggttcgaaccccgaattccccacttattcacc |
254 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
30696764 |
caggggtcggggttcgaaccccggattccccacttattcacc |
30696805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 235
Target Start/End: Complemental strand, 35948231 - 35948186
Alignment:
| Q |
190 |
gtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
35948231 |
gtagggatatcgcattttatatgcaggagccggggttcgaaccccg |
35948186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 42381173 - 42381120
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||| ||||||| ||||||||||| |
|
|
| T |
42381173 |
tagctcagttggtagggatattgcatgttatatgtaggggtcggggttcgaacc |
42381120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 166 - 250
Target Start/End: Complemental strand, 42411556 - 42411471
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttatt |
250 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | |||| ||||||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
42411556 |
gtccccgtgagcatagctcagttggcagggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
42411471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 182 - 235
Target Start/End: Original strand, 43905723 - 43905776
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||||| || |||||||||||||| |
|
|
| T |
43905723 |
ctcagttggtagggatattgcatgttatatgcagggatcggggttcgaaccccg |
43905776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 253
Target Start/End: Complemental strand, 48968313 - 48968224
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||| ||||||||||| |||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
48968313 |
agtccccgtgagcatagttcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
48968224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 3036123 - 3036059
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||||| | ||||||||||||| |
|
|
| T |
3036123 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccg |
3036059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 3847683 - 3847747
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||| ||||| |
|
|
| T |
3847683 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgatccccg |
3847747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 203 - 235
Target Start/End: Complemental strand, 7513417 - 7513385
Alignment:
| Q |
203 |
attttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7513417 |
attttatatgcaggggtcagggttcgaaccccg |
7513385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 10402443 - 10402507
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||| ||||| |||| ||||||||||||||| | |||||||||||| |
|
|
| T |
10402443 |
cgtgagcttaactcagttggtagagatattgcatattatatgcaggggtcggagttcgaaccccg |
10402507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 257
Target Start/End: Complemental strand, 12820507 - 12820415
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| |||||||||||||||| ||| || || | ||||| ||||||||||||||| ||||| |||||| | | |||||||||||||||||| |
|
|
| T |
12820507 |
gtccccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcggggttagaaccctggacaccccacttattcacctta |
12820415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 14149786 - 14149874
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| ||||| |||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
14149786 |
gtccccgtgaccatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
14149874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 231
Target Start/End: Complemental strand, 17447261 - 17447197
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||||||| |||||| | ||||||||||||| || |||||||||||| || |||||||||| |
|
|
| T |
17447261 |
tcctcgtgagcttagctcggttggtagggatatcacactttatatgcaggagttggggttcgaac |
17447197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 235
Target Start/End: Complemental strand, 17617028 - 17616984
Alignment:
| Q |
191 |
tagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
17617028 |
tagggatattgcattttatatgcaggggccggggttcgaaccccg |
17616984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 19963801 - 19963845
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
19963801 |
tggtagggatattgcatattatatgcaggggtcggggttcgaacc |
19963845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 26868351 - 26868414
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
26868351 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggag-ccgggttcgaaccccg |
26868414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 27921895 - 27921958
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||| ||||||||||||| | ||||||||||||| |
|
|
| T |
27921895 |
cgtgagcatagctcagttggtagggacat-gcattattatatgcaggggccggggttcgaacccc |
27921958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 33076531 - 33076615
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||| |||| || ||||| ||||||||||||||| |||||||||||||| | ||| |||||||||||||| |
|
|
| T |
33076531 |
cgtgagcatagctcagttgg--gggacat-gcattattatatgcaggggtcggggttcgaaccccggacaccctacttattcacctta |
33076615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 235
Target Start/End: Original strand, 33530791 - 33530859
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| ||||| | |||||||||||| |||| ||||||| |||| || |||||||||||||| |
|
|
| T |
33530791 |
tcctcgtgagcttagcttaattggtagggatattgcatattatatgtagggatcggggttcgaaccccg |
33530859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 34040430 - 34040490
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| |||||||| || ||| |||| |||||||||||| |||||||||||||||||| |
|
|
| T |
34040430 |
cgtgagcttagctcagttgatagaaatattgcattttatatgtaggggtcagggttcgaac |
34040490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 234
Target Start/End: Original strand, 34932496 - 34932560
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||| |||||||| ||||||| |||| ||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
34932496 |
tcgtgagcttagctcagttggtaggaatattgcacgttatatgtaggggtcggggttcgaacccc |
34932560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 35219568 - 35219505
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||| ||||||| ||| |||||||||||||| |
|
|
| T |
35219568 |
cgtgagcttagctcagttggtagggatattgcatatta-atgcaggagtcggggttcgaaccccg |
35219505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 37935863 - 37935923
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
37935863 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaac |
37935923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 256
Target Start/End: Original strand, 38690686 - 38690750
Alignment:
| Q |
192 |
agggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||| |||| ||||||||||||||| |||||||||||||| | |||||||||||| |||| |
|
|
| T |
38690686 |
agggataatgcatattatatgcaggggtcggggttcgaaccccggacaccccacttattctcctt |
38690750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 45112179 - 45112115
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
45112179 |
cgtgagcttacctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
45112115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 47890708 - 47890760
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||| ||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
47890708 |
ctcagttggtagagatattgcatattatatgcaggggtcggggttcgaacccc |
47890760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 48615540 - 48615476
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||| |||||||||| | | |||||||||||||| |
|
|
| T |
48615540 |
cgtgagcataactcagttggtagggatattgcatattatatgcagaagccggggttcgaaccccg |
48615476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 48798281 - 48798344
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||||| ||||||| |||||||||||||| |
|
|
| T |
48798281 |
cgtgagcttagctcagttggtagggatattgcattttata-gcaggggctggggttcgaaccccg |
48798344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 53815689 - 53815777
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
53815689 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcac |
53815777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 188 - 235
Target Start/End: Original strand, 2222558 - 2222605
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
2222558 |
tggtagggatattgcatgttatatgcaggggccggggttcgaaccccg |
2222605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 3764076 - 3764013
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| ||| ||||||||||||| ||||||||||||| |
|
|
| T |
3764076 |
cgtgagcttagctcagttggtagggatattacatattatatgcaggggctggggttcgaacccc |
3764013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 6637783 - 6637732
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||| |||| |
|
|
| T |
6637783 |
ttatatgcaggggttggggttcgaaccccgaacaccccacttattcatctta |
6637732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 238
Target Start/End: Complemental strand, 8433691 - 8433624
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaat |
238 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||| |||| | |||||||||||| ||||| |
|
|
| T |
8433691 |
cgtgagcttagctcagttggtagggatattgcatattatatccaggagctagggttcgaaccgcgaat |
8433624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 8848279 - 8848216
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| ||| |||| |||||||||||| |||| |||||| |||||| | |||||||||||||| |
|
|
| T |
8848279 |
gtgagcttagttcagttggtagggatattgcatattatatacaggggccggggttcgaaccccg |
8848216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 12856183 - 12856269
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| ||| ||| | ||||||| ||||||| | |||||||||||| | |||||||||||||||||| |
|
|
| T |
12856183 |
cgtgagcatagctcagttggtagg-ataatgcactattatatgaaggggtcggagttcgaaccccggacaccccacttattcacctta |
12856269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 20753221 - 20753135
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| | || ||||| ||||||| ||||| | |||||||||||||| | || ||||||||||||||| |
|
|
| T |
20753221 |
cgtgagcatagctcagttggtaggaaaat-gcattattatatgtaggggccggggttcgaaccccggacaccacacttattcacctta |
20753135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 218
Target Start/End: Complemental strand, 22788742 - 22788695
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
22788742 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggg |
22788695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 218
Target Start/End: Complemental strand, 24680154 - 24680107
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
24680154 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggg |
24680107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 25235865 - 25235802
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| ||||| || |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
25235865 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
25235802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 190 - 237
Target Start/End: Complemental strand, 27434199 - 27434152
Alignment:
| Q |
190 |
gtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||||| | || |||||||||| ||||||||||||||||||||| |
|
|
| T |
27434199 |
gtagggatattgaatattatatgcagaggtcagggttcgaaccccgaa |
27434152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 29329891 - 29329828
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| ||||||| |||| | |||||||||| ||||| | ||||||||||||| |
|
|
| T |
29329891 |
cgtgagcttagctcagttggtaggaatattgtattttatatgtaggggccggggttcgaacccc |
29329828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 218
Target Start/End: Original strand, 30217601 - 30217648
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
30217601 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggg |
30217648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 32885687 - 32885773
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||||||||||||||| | ||||||||| || | |||||||||||||||||| |
|
|
| T |
32885687 |
cgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggtcggagttcgaacctcggacaccccacttattcacctta |
32885773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 174 - 256
Target Start/End: Complemental strand, 35230388 - 35230306
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcattt-tatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| |||||||| ||||| ||||||||||| || | ||||||||||| ||||| |
|
|
| T |
35230388 |
gagcatagctcagttggtagggatat-gcattgctatatgcatgggtcggggttcgaacctcggacaccccacttatttacctt |
35230306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 37032240 - 37032189
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| || ||||||||||| | |||||||||||||||||| |
|
|
| T |
37032240 |
ttatatgcaggggtcgggattcgaaccccggacaccccacttattcacctta |
37032189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 43271785 - 43271722
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| ||| |||| || ||||||||| |||| |||||||||||| ||||||||||||||| |
|
|
| T |
43271785 |
cgtgagcttagttcagttgatagggatattgcatattatatgcagggaccagggttcgaacccc |
43271722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 166 - 256
Target Start/End: Complemental strand, 49039546 - 49039456
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| || ||||| |||||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
49039546 |
gtccccgtgagcatagctcagttggcagggacat-gcattgttatatgcagggactggggttcgaaccccggacaccccacttattcacctt |
49039456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 2771038 - 2771104
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| ||||||||||| || |||||| |||| |||||||||||| | | |||||||||||||| |
|
|
| T |
2771038 |
cgtgagcttagctcagctgatatggatattgcatattatatgcagggaccggagttcgaaccccgaa |
2771104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 3784914 - 3784979
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| | ||||||||| ||||||||||||||||||| |
|
|
| T |
3784914 |
cgtgagcttagctcaattggtagggatattgcataatttatgcaggg-tcagggttcgaaccccgaa |
3784979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 230
Target Start/End: Complemental strand, 17815492 - 17815434
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
|||||| ||| |||| |||||||||||| ||| ||||||||||||||| ||||||||| |
|
|
| T |
17815492 |
gtgagcttagttcagttggtagggatattacatattatatgcaggggtcggggttcgaa |
17815434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 233
Target Start/End: Original strand, 19594231 - 19594297
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||||||| || ||||| || ||| ||||| |||| ||||||| ||||| |||||||||||||| |
|
|
| T |
19594231 |
tcctcgtgagcttaactcagttgatagagatattgcatattatatgtaggggccagggttcgaaccc |
19594297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 257
Target Start/End: Original strand, 20610739 - 20610824
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||| ||||| || ||||| ||||||||||||| | |||||||||| ||| | ||||||||||||||||| |
|
|
| T |
20610739 |
gtgagcatagctcagttggcagggacat-gcattgttatatgcaggggccggggttcgaactccggacatcccacttattcacctta |
20610824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 201 - 235
Target Start/End: Complemental strand, 23176759 - 23176725
Alignment:
| Q |
201 |
gcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
23176759 |
gcattttatatgcaggggtcggggttcgaaccccg |
23176725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 252
Target Start/End: Complemental strand, 33944459 - 33944378
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattca |
252 |
Q |
| |
|
|||||||||| ||||| ||||||| ||| ||||| ||||||||||||| | ||||||||||| ||||| | ||||||||||| |
|
|
| T |
33944459 |
cgtgagcataactcagttggtagg-ataatgcattattatatgcaggggccggggttcgaacctcgaatactccacttattca |
33944378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 229
Target Start/End: Complemental strand, 35207219 - 35207161
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcga |
229 |
Q |
| |
|
||||||| || ||||| || ||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
35207219 |
cgtgagcttaactcagttgatagggatattgcatattatatgcaggagtcagggttcga |
35207161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 38228439 - 38228505
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| ||| |||| |||||||||||| |||| ||||||| ||||| | |||||||||| ||||| |
|
|
| T |
38228439 |
cgtgagcttagatcagttggtagggatattgcatgttatatgtaggggccggggttcgaactccgaa |
38228505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 43207671 - 43207737
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | ||||||||| |||||| |
|
|
| T |
43207671 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagcttgggttcgaatcccgaa |
43207737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 250
Target Start/End: Original strand, 2565254 - 2565339
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttatt |
250 |
Q |
| |
|
|||| |||||||||||||||| || ||||| | ||||| ||||||||||||||| | ||||||| |||||| ||||||||||| |
|
|
| T |
2565254 |
gtccccgtgagcatagctcagttgacagggacaatgcattgttatatgcaggggtcggagttcgaatcccgaacaccccacttatt |
2565339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 4234353 - 4234292
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||| ||||||||||| | | ||||||||||| |
|
|
| T |
4234353 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaacc |
4234292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 256
Target Start/End: Original strand, 6930561 - 6930638
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||| ||||||||| |||| |||||||||||| | || ||| ||| ||| | ||||||||||||||||| |
|
|
| T |
6930561 |
tagctcagctgctagggatattgcataatatatgcaggggccgggattcaaactccggacaccccacttattcacctt |
6930638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 257
Target Start/End: Original strand, 9084759 - 9084844
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||| ||| ||||| | ||||| ||||||||||||||| || |||||||| || | ||||||||||||| |||| |
|
|
| T |
9084759 |
tgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcgggattcgaacctcggacaccccacttattcatctta |
9084844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 170 - 235
Target Start/End: Complemental strand, 15064271 - 15064206
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||| |||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
15064271 |
tcgtgagtttagctcagttggtaggaatattgcatattatatgcaggagtcgaggttcgaaccccg |
15064206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 252
Target Start/End: Original strand, 16556490 - 16556531
Alignment:
| Q |
211 |
tgcaggggtcagggttcgaaccccgaattccccacttattca |
252 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
16556490 |
tgcaggggtcggggttcgaaccccgaacaccccacttattca |
16556531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 235
Target Start/End: Original strand, 16975069 - 16975138
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||| || |||| | |||||| |||||||||||||||||||| |
|
|
| T |
16975069 |
gtcctcgtaagcttagctcaattggtagggacattgcataatttatgcatgggtcagggttcgaaccccg |
16975138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 216
Target Start/End: Complemental strand, 26919536 - 26919491
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
26919536 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
26919491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 256
Target Start/End: Complemental strand, 42758258 - 42758175
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||||| | ||||||| || ||||| ||||||||||||| | |||||||||||| | | ||||||||||||||||| |
|
|
| T |
42758258 |
gtgagcatagctcagtttgtagggacat-gcattattatatgcaggggcc-gggttcgaaccctggacaccccacttattcacctt |
42758175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 236
Target Start/End: Original strand, 45673654 - 45673719
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccga |
236 |
Q |
| |
|
||||||| || ||||| ||||||| |||| |||| |||||||||||| | ||||||||||||||| |
|
|
| T |
45673654 |
cgtgagcttaactcagttggtaggaatattgcatattatatgcagggattggggttcgaaccccga |
45673719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 235
Target Start/End: Complemental strand, 53376744 - 53376683
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| ||||||| |||||||||||| |||| ||||||||| ||| | |||||||||||||| |
|
|
| T |
53376744 |
gagcttagctcaattggtagggatattgcatgttatatgcaagggccggggttcgaaccccg |
53376683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 1458078 - 1458022
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| || ||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
1458078 |
tagctcagttgatagggatattgcatattatatgcaggagccggggttcgaaccccg |
1458022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 3157277 - 3157229
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttc |
227 |
Q |
| |
|
|||||||| ||||||| |||| |||| ||||||||||||||| |||||| |
|
|
| T |
3157277 |
tagctcagttggtaggaatattgcatattatatgcaggggtcggggttc |
3157229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 3815062 - 3815126
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||| || |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
3815062 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggagctggggttcgaaccccg |
3815126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 4105729 - 4105773
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcag |
215 |
Q |
| |
|
||||||| |||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
4105729 |
cgtgagcttagctcagttgatagggatattgcattttatatgcag |
4105773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 4700998 - 4700942
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| | || ||||||||||||||| | || ||||||||| |
|
|
| T |
4700998 |
tagctcagttggtagggatattgtatattatatgcaggggtcggtgtccgaaccccg |
4700942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 9761117 - 9761181
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
9761117 |
cgtgagcttacctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccg |
9761181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 181 - 253
Target Start/End: Complemental strand, 13264332 - 13264260
Alignment:
| Q |
181 |
gctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||| || | |||||||||||||| | |||||||| ||||| |
|
|
| T |
13264332 |
gctcagttggtagggatattgcatattatatgcaaggaccggggttcgaaccccggacaccccacttcttcac |
13264260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 235
Target Start/End: Original strand, 18002346 - 18002390
Alignment:
| Q |
191 |
tagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
18002346 |
tagggatatcgcattttatatgtaggggttgaggttcgaaccccg |
18002390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 23705221 - 23705157
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||| ||||||| | |||||||||||||| |
|
|
| T |
23705221 |
cgtgagcttagctcagttggtagggatattgcatattacatgcaggagctggggttcgaaccccg |
23705157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 216
Target Start/End: Complemental strand, 23787406 - 23787362
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||||| ||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
23787406 |
gtgagcataactcagttggtagggatattgcatattatatgcagg |
23787362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 247
Target Start/End: Complemental strand, 27362897 - 27362821
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||| || ||||| |||||| ||||| ||| ||||||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
27362897 |
cgtgagcttaactcagttggtagcgatattacatattatatgcaggggccgacgttcgaaccccgaactccccactt |
27362821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 29505803 - 29505739
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || || || ||||||||||||| |||||||||||||| || | ||||||||| |||| |
|
|
| T |
29505803 |
cgtgagcttaacttagttggtagggatatcacattttatatgcagaggccggggttcgaatcccg |
29505739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 31852681 - 31852617
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||| ||| |||| ||||||| |||||| |||||||||||||| |
|
|
| T |
31852681 |
cgtgagcttatctcagttggtagggttattgcatattatatgtaggggttggggttcgaaccccg |
31852617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 165 - 229
Target Start/End: Complemental strand, 33933813 - 33933749
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcga |
229 |
Q |
| |
|
||||| ||||||| |||||||| ||||||||| || |||| |||||||||||| | |||||||| |
|
|
| T |
33933813 |
agtccccgtgagcttagctcagttggtagggacattgcataatatatgcaggggccggggttcga |
33933749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 36132239 - 36132295
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||||| |||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
36132239 |
tagctcaattggtaggaatattgcatattatatgcaggagtcggggttcgaaccccg |
36132295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 36954134 - 36954218
Alignment:
| Q |
171 |
cgtgagcatagctca-gctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||||| | ||| ||||| | ||||| ||||||||||||||| |||||||||||||| | ||||| |||||||| |
|
|
| T |
36954134 |
cgtgagcatagctcaagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccatttattcac |
36954218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 231
Target Start/End: Original strand, 37728939 - 37728998
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||||| |||| |||||||||||| ||||| ||||||||||||||| ||||||||| |
|
|
| T |
37728939 |
gtgagcatagttcagttggtagggatat-gcattattatatgcaggggtcgaggttcgaac |
37728998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 40994171 - 40994107
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| ||| || ||||||||| |||| |
|
|
| T |
40994171 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggagttggggttcgaatcccg |
40994107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 42231514 - 42231578
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| ||||||| |||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
42231514 |
cgtgagcttaactcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccg |
42231578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 48825886 - 48825822
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || |||| |||||||||||||| |||||||||||||| | | ||||| |||||||| |
|
|
| T |
48825886 |
cgtgagcttaactcaattggtagggatatcgaattttatatgcaggagccggggttagaaccccg |
48825822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 52757346 - 52757286
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| |||||||| ||| ||| |||| |||| |||||||||||||| |||||||||| |
|
|
| T |
52757346 |
cgtgagcttagctcagttggcaggaatattgcatattatatgcaggggttggggttcgaac |
52757286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 52798280 - 52798343
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||| | ||| |||||||||||||| |
|
|
| T |
52798280 |
cgtgagcttaactcagttggtagggatattgcatattatatgca-gagtcggggttcgaaccccg |
52798343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 6e-22; HSPs: 101)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 172 - 257
Target Start/End: Original strand, 23403307 - 23403391
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||||||||| ||| ||||| ||||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23403307 |
gtgagcatagctcagttggtagggacatcacattt-atatgcaggggcccgggttcgaaccccggattccccacttattcacctta |
23403391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 43936703 - 43936762
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43936703 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcagggttcgaa |
43936762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 33262452 - 33262505
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33262452 |
tagctcagctggtagggatatcgcattttatatgcaggggtcggggttcgaacc |
33262505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 166 - 257
Target Start/End: Original strand, 11133069 - 11133161
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| | ||||| ||||||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
11133069 |
gtccccgtgagcatagctcagttggtagggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctta |
11133161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 38525621 - 38525559
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| ||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38525621 |
cgtgagcttagctcagttggtaaggatattgcattttatatgcaggggtcagggttcgaaccc |
38525559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 169 - 254
Target Start/End: Original strand, 41699099 - 41699184
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacc |
254 |
Q |
| |
|
|||||||||||| ||||| ||||||| |||| ||||| ||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
41699099 |
ctcgtgagcataactcagttggtagg-atattgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcacc |
41699184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 27449185 - 27449246
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
27449185 |
cgtgagcatagctcagttggtagggatattgcattttatatgcatgggtcggggttcgaacc |
27449246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 38557291 - 38557227
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
38557291 |
cgtgagcttaactcagttggtagggatatggcattttatatgcaggggtcggggttcgaaccccg |
38557227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 40688711 - 40688643
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||| | |||||||| |||||| ||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
40688711 |
tcctcgtgatcttagctcagttggtagagatattgcattttatatgcaggggccagggttcgaaccccg |
40688643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 166 - 257
Target Start/End: Original strand, 23405193 - 23405284
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||| || |||| |||||||||||||| |||||||||||| | | |||||||||||||||||| |
|
|
| T |
23405193 |
gtccccgtgagcttagctcagttggtagggacattgcataatatatgcaggggtcggggttcgaaccctggacaccccacttattcacctta |
23405284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 44822425 - 44822488
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||| | | ||||||||||||| |
|
|
| T |
44822425 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccggggttcgaacccc |
44822488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 2289612 - 2289674
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| ||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
2289612 |
cgtgagcttagctcagttggtaggaatattgcatattatatgcaggggtcagggttcgaaccc |
2289674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 3301813 - 3301879
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| ||||||| |||||||||||| ||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
3301813 |
cgtgagcttagctcatttggtagggatattgcattttatatacaggggtcggggttcgaaccccgaa |
3301879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 4183178 - 4183244
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||||| |
|
|
| T |
4183178 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccgaa |
4183244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 29449452 - 29449513
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||||| ||||||||||||| ||||||||||||||||| | ||||||||||||| |
|
|
| T |
29449452 |
tgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaacccc |
29449513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 2643699 - 2643763
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
2643699 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
2643763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 3438950 - 3439014
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
3438950 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
3439014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 22653712 - 22653648
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
22653712 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
22653648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 33229001 - 33228937
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
33229001 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
33228937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 34613981 - 34614045
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
34613981 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
34614045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 44857306 - 44857238
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| |||| ||||||||||||| | ||||||||||||| |
|
|
| T |
44857306 |
tcctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccg |
44857238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 8250369 - 8250306
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | ||||||||||||| |
|
|
| T |
8250369 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacccc |
8250306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 14307790 - 14307708
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||| |||||| ||||||||| || ||||| ||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14307790 |
cgtgagcatggctcagttggtagggacat-gcattgttatatgcaggggtcgaggttcgaaccccgaacaccccacttattcac |
14307708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 167 - 230
Target Start/End: Original strand, 15764928 - 15764991
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
15764928 |
tcctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaa |
15764991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 170 - 231
Target Start/End: Original strand, 40864400 - 40864461
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||| |||||||| ||||||| |||| |||||||||||||||||| | |||||||||| |
|
|
| T |
40864400 |
tcgtgagcttagctcagttggtaggaatattgcattttatatgcaggggccggggttcgaac |
40864461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 162 - 257
Target Start/End: Complemental strand, 3037728 - 3037632
Alignment:
| Q |
162 |
gggagtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||| |||||| ||||| ||| |||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
3037728 |
gggagtcctcgtaagcataactcagttggctgggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
3037632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 6331564 - 6331627
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
6331564 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggag-ccgggttcgaaccccg |
6331627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 247
Target Start/End: Complemental strand, 28195206 - 28195126
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| |||| ||||||||| ||| |||||| ||||||| || |||||||| |
|
|
| T |
28195206 |
tcctcgtgagcttagctcagttggtagggatattgcatattatatgcaagggcaggggttctaaccccggataccccactt |
28195126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 40535517 - 40535453
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||| |||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
40535517 |
cgtgagcttagctcagttggtacggatattgcatattatatgcaggggccggggttcgaaccccg |
40535453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 41509518 - 41509582
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
41509518 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
41509582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 580879 - 580793
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||||||||||||| | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
580879 |
cgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
580793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 3287123 - 3287060
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| ||| |||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
3287123 |
gtgagcttagctcagttggaagggatattgcatattatatgcaggggccggggttcgaaccccg |
3287060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 7086252 - 7086338
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||| ||||||||||||| | || ||||||||||||| ||||| |||||||||||| |
|
|
| T |
7086252 |
cgtgagcatagctcagttggtagggcaat-gcattattatatgcaggggccgggattcgaaccccgaacaccccaattattcacctta |
7086338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 190 - 233
Target Start/End: Complemental strand, 28692534 - 28692491
Alignment:
| Q |
190 |
gtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
28692534 |
gtagggatattgcattttatatgcaggggtcggggttcgaaccc |
28692491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 40363139 - 40363076
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
40363139 |
cgtgagcttaactcagttggtagggatattgcatattatatgtaggggtcggggttcgaacccc |
40363076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 44187702 - 44187785
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||| |||| ||| ||||||| ||||| ||||||||||||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
44187702 |
cgtgagcatagttcagttggcagggataatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcac |
44187785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 43895915 - 43895977
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| ||||||||||||| ||||||||||||| ||| | ||||| |||||| |
|
|
| T |
43895915 |
cgtgagcttagctcagttggtagggatatcacattttatatgcaagggccggggtttgaaccc |
43895977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 44948598 - 44948660
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||||| | |||||||||||| |
|
|
| T |
44948598 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggaccggggttcgaaccc |
44948660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 1844827 - 1844880
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| | ||||||||||| |
|
|
| T |
1844827 |
tagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacc |
1844880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 235
Target Start/End: Complemental strand, 11093837 - 11093792
Alignment:
| Q |
190 |
gtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
11093837 |
gtagggatatcgcatattatatgcaggagtcggggttcgaaccccg |
11093792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 236
Target Start/End: Original strand, 19684075 - 19684140
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccga |
236 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | ||||||||||||||| |
|
|
| T |
19684075 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccga |
19684140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 30392898 - 30392837
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| ||||||| ||| ||| ||||||||||||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatgtaggagtcggggttcgaacccc |
30392837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 37063533 - 37063582
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
37063533 |
ctcagttggtagggatattgcatattatatgcaggggccagggttcgaac |
37063582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 38179305 - 38179252
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
38179305 |
tagctcagttggtagggatattgcattttatatgcaggggctggggttcgaacc |
38179252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 466674 - 466610
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||| ||||||||| | ||| ||||||||| |||| |
|
|
| T |
466674 |
cgtgagcatagctcagttggtagggatattacatattatatgcaagagtcggggttcgaaacccg |
466610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 3446732 - 3446796
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | ||||||||||||| |
|
|
| T |
3446732 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg |
3446796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 4562812 - 4562756
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
4562812 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
4562756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 237
Target Start/End: Complemental strand, 10463271 - 10463199
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatc-gcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||| | |||||||||||||||||| | |||||||||||||||| |
|
|
| T |
10463271 |
gtccccgtgagcttagctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccgaa |
10463199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 17034737 - 17034801
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| ||||||||||| ||| ||||||||| |||| |
|
|
| T |
17034737 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggagtcggggttcgaatcccg |
17034801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 17078459 - 17078523
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| | || ||||||||||| ||| ||||||||| |||| |
|
|
| T |
17078459 |
cgtgagcttagctcagttggtagggatattgtatattatatgcaggagtcggggttcgaatcccg |
17078523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 19281610 - 19281674
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
19281610 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccg |
19281674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Complemental strand, 21970541 - 21970453
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| || ||||| | ||||| |||||||||||| || |||||||||||||| || |||| ||||||||| |
|
|
| T |
21970541 |
gtccccgtgagcatagctcagttgacagggacaatgcattattatatgcagggatcggggttcgaaccccggataccccgcttattcac |
21970453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 29034969 - 29035057
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
29034969 |
gtccccgtgagcatagctcacttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
29035057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 30390429 - 30390373
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
30390429 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
30390373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 33563266 - 33563215
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||||||||| | |||||||||||||||||| ||||||||||||| |
|
|
| T |
33563266 |
ctcagttggtagggatattgtattttatatgcaggggtc-gggttcgaacccc |
33563215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 36182644 - 36182708
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
36182644 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagcaggggttcgaaccccg |
36182708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 257
Target Start/End: Original strand, 39118387 - 39118478
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||| || ||||| ||||||||| || |||| ||||||||||||| ||| ||||||| |||||| |||||||||||| ||||| |
|
|
| T |
39118387 |
gtcctcgtgagcgtaactcagttggtagggacata-cattgttatatgcaggggccagagttcgaatcccgaacaccccacttattctcctta |
39118478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 166 - 256
Target Start/End: Original strand, 1244563 - 1244653
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattt-tatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||| |||| ||| ||||| || |||| ||||||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
1244563 |
gtcctcgtgagcatagttcagttggcagggacata-cattgctatatgcaggggtgggggttcgaaccccggacaccccacttattcacctt |
1244653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 1500971 - 1501026
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
1500971 |
tagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
1501026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 2806569 - 2806507
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| | || ||||||| ||||||| ||||||||||||| |
|
|
| T |
2806569 |
cgtgagcttagctcagttggtagggatattgtatattatatgtaggggtc-gggttcgaacccc |
2806507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 235
Target Start/End: Original strand, 5612957 - 5613020
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| ||| |||||||| |||| ||||||||| ||| | |||||||||||||| |
|
|
| T |
5612957 |
gtgagcttagctcagttggcagggatattgcatattatatgcaagggccggggttcgaaccccg |
5613020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 6636034 - 6635971
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||| |||||||||||| |||||||||||||| |
|
|
| T |
6636034 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggacgggggttcgaaccccg |
6635971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 9520842 - 9520893
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| |||||| || |||||||||||||| |||||||||||||||||| |
|
|
| T |
9520842 |
ttatatgtaggggttagagttcgaaccccgaacaccccacttattcacctta |
9520893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 9796931 - 9796982
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| |||||||||||||| | ||||||||||||| |||| |
|
|
| T |
9796931 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttattcatctta |
9796982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 10262773 - 10262824
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
10262773 |
ttatatgcaggggtcggggttcgaaccccagacaccccacttattcacctta |
10262824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 235
Target Start/End: Complemental strand, 15069846 - 15069803
Alignment:
| Q |
192 |
agggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||||||||||||| |
|
|
| T |
15069846 |
agggatattgtattttatatgcaggggtcggggttcgaaccccg |
15069803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 17154683 - 17154734
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||| | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
17154683 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
17154734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 214
Target Start/End: Complemental strand, 27497596 - 27497553
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgca |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||||||||| |
|
|
| T |
27497596 |
cgtgagcatagctcagttggtagggatattgcatgttatatgca |
27497553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 28153209 - 28153146
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| || ||||| |||||||||||| |||| ||||||||||| || |||||||||||||| |
|
|
| T |
28153209 |
gtgagcttaactcagttggtagggatattgcatgttatatgcaggattcggggttcgaaccccg |
28153146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 182 - 237
Target Start/End: Complemental strand, 33041920 - 33041865
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||| || |||||||||||||||||| |
|
|
| T |
33041920 |
ctcagttggtagggatattgcatattatatgcaaaggccagggttcgaaccccgaa |
33041865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 182 - 237
Target Start/End: Complemental strand, 33816473 - 33816418
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||| |||||| ||||| |||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
33816473 |
ctcagttggtagagatattgcatattatatgcaggggtcgggtttcgaaccccgaa |
33816418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 218
Target Start/End: Original strand, 38400312 - 38400359
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
38400312 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggg |
38400359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 5521288 - 5521226
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||| ||||||||||||| | ||||||||||| |
|
|
| T |
5521288 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccgaggttcgaaccc |
5521226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 201 - 235
Target Start/End: Original strand, 5947898 - 5947932
Alignment:
| Q |
201 |
gcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
5947898 |
gcattttatatgcaggggtcggggttcgaaccccg |
5947932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 257
Target Start/End: Original strand, 8702583 - 8702660
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| ||| ||||||||| |||| ||||||||| ||| | |||| |||||||||| |||||||| |||||||||| |
|
|
| T |
8702583 |
tagctcatctgatagggatattgcatattatatgca-gggccgaggtttgaaccccgaactccccactgattcacctta |
8702660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 257
Target Start/End: Original strand, 8732239 - 8732316
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| ||| ||||||||| |||| ||||||||| ||| | |||| |||||||||| |||||||| |||||||||| |
|
|
| T |
8732239 |
tagctcatctgatagggatattgcatattatatgca-gggccgaggtttgaaccccgaactccccactgattcacctta |
8732316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 256
Target Start/End: Original strand, 12206532 - 12206582
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| |||| |||||||||||| |
|
|
| T |
12206532 |
ttatattcaggggtcggggttcgaaccccgaacaccccgcttattcacctt |
12206582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 201 - 235
Target Start/End: Complemental strand, 23984261 - 23984227
Alignment:
| Q |
201 |
gcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
23984261 |
gcattttatatgcaggggccagggttcgaaccccg |
23984227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 180 - 234
Target Start/End: Original strand, 34355732 - 34355786
Alignment:
| Q |
180 |
agctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||||||| | || ||||||||||||| | ||||||||||||| |
|
|
| T |
34355732 |
agctcagttggtagggatattgtatattatatgcaggggccggggttcgaacccc |
34355786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 219
Target Start/End: Original strand, 41566758 - 41566812
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggt |
219 |
Q |
| |
|
||||| ||||||| |||||||| ||||||| |||| |||| |||||||||||||| |
|
|
| T |
41566758 |
agtccccgtgagcttagctcagttggtaggaatattgcatattatatgcaggggt |
41566812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 256
Target Start/End: Complemental strand, 5029195 - 5029111
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||||| ||||||| |||| ||||| |||||||||| || | | ||||||| | |||| ||||||||||||||||| |
|
|
| T |
5029195 |
gtgagcatagctcagttggtaggtatat-gcattattatatgcagaggccggagttcgaatctcgaacaccccacttattcacctt |
5029111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 216
Target Start/End: Original strand, 18694787 - 18694832
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
18694787 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
18694832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 257
Target Start/End: Complemental strand, 22297550 - 22297462
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||||| ||||||| || ||||| ||||||||||||| |||||||||||||| | ||||| |||||||||||| |
|
|
| T |
22297550 |
ctcgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggcaggggttcgaaccccggacaccccatttattcacctta |
22297462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 216
Target Start/End: Complemental strand, 25857363 - 25857318
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
25857363 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
25857318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 257
Target Start/End: Original strand, 29664595 - 29664688
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||| ||||||||||||||| ||| ||||| | ||||| ||||||||||||||| |||||| || |||| | ||||||||||||| |||| |
|
|
| T |
29664595 |
agtccccgtgagcatagctcaattggcagggacaatgcattgttatatgcaggggtcggggttcaaatcccggacaccccacttattcatctta |
29664688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 228
Target Start/End: Complemental strand, 33233290 - 33233233
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcg |
228 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| ||| ||||||| |
|
|
| T |
33233290 |
cgtgagcttatctcagttggtagggatattgcatattatatgcaggagtcggggttcg |
33233233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 253
Target Start/End: Complemental strand, 36386207 - 36386128
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| ||||||||||||||| ||||| ||| | || | |||||||||||||| |
|
|
| T |
36386207 |
tgagcatagctcagttggtagggatat-gcattgttatatgcaggggtc-gggtttgaatctcggacaccccacttattcac |
36386128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 1071472 - 1071536
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||| |||||| | || ||||||||||| | | |||||||||||||| |
|
|
| T |
1071472 |
cgtgagcttagctcagttggtatggatattgtatattatatgcaggagccggggttcgaaccccg |
1071536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 219
Target Start/End: Original strand, 1232194 - 1232242
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggt |
219 |
Q |
| |
|
||||||| || ||||| ||||| ||||||| |||||||||||||||||| |
|
|
| T |
1232194 |
cgtgagcttaactcagttggtaaggatatcacattttatatgcaggggt |
1232242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 173 - 233
Target Start/End: Original strand, 8322810 - 8322870
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||| ||| |||| |||||||| ||| |||| |||||| |||||||| |||||||||||| |
|
|
| T |
8322810 |
tgagcttagttcagttggtaggggtattgcatattatatacaggggtcggggttcgaaccc |
8322870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 11050825 - 11050765
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| |||||||| |||||||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
11050825 |
cgtgagcttagctcagttggtagggatattacatattatatgcaggggctggggttcgaac |
11050765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 219
Target Start/End: Original strand, 16040239 - 16040291
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggt |
219 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||| |||| |||| ||||||||| |
|
|
| T |
16040239 |
tcctcgtgagcttagttcagttggtagggatattgcatgttatttgcaggggt |
16040291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 17487714 - 17487770
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||| || |||||||||||||| |
|
|
| T |
17487714 |
tagctcagttggtagggatattgcatattatatgcagtggctggggttcgaaccccg |
17487770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 18278477 - 18278421
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | ||||||||| |||| |
|
|
| T |
18278477 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccg |
18278421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 214
Target Start/End: Complemental strand, 20017123 - 20017075
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgca |
214 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| || ||||| |||||||| |
|
|
| T |
20017123 |
gtcctcgtgagcttagctcagctggtaaggacattgcattatatatgca |
20017075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 20296420 - 20296484
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| || || |||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
20296420 |
cgtgagcttagctcagttgataaggatattgcatattatatgcaggagccggggttcgaaccccg |
20296484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 235
Target Start/End: Original strand, 20641876 - 20641920
Alignment:
| Q |
191 |
tagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
20641876 |
tagggatatcgcattttatatgtaggggttgaggttcgaaccccg |
20641920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 235
Target Start/End: Complemental strand, 30871365 - 30871325
Alignment:
| Q |
195 |
gatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||| |||| |
|
|
| T |
30871365 |
gatattgcattttacatgcaggggtcagggttcgaatcccg |
30871325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 32609255 - 32609195
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||| | ||| |||||||||| |
|
|
| T |
32609255 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaagagtcggggttcgaac |
32609195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 258
Target Start/End: Original strand, 32891633 - 32891685
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcaccttac |
258 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
32891633 |
ttatatgcaggggttggggttcgaaccctgaacaccccacttattcatcttac |
32891685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 254
Target Start/End: Complemental strand, 36520841 - 36520793
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacc |
254 |
Q |
| |
|
||||||| ||||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
36520841 |
ttatatgtaggggtcggggttcgaaccccggacaccccacttattcacc |
36520793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 9e-21; HSPs: 117)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 25729508 - 25729445
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25729508 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaacccc |
25729445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 41477426 - 41477360
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41477426 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggctggggttcgaaccccgaa |
41477360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 174 - 235
Target Start/End: Original strand, 18638603 - 18638664
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
18638603 |
gagcttagctcagttggtagggatatcgcattttatatgcaggggccggggttcgaaccccg |
18638664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 13622014 - 13621950
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
13622014 |
cgtgagcttagctcagttggtagggatatcgcatattatatgcaggggccggggttcgaaccccg |
13621950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 17666008 - 17666072
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||| |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
17666008 |
cgtgagcttagctcagttggtaggaatattgcatattatatgcaggggtcagggttcgaaccccg |
17666072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 18872520 - 18872606
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
18872520 |
cgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcacctta |
18872606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 174 - 235
Target Start/End: Original strand, 24033082 - 24033143
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
24033082 |
gagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaaccccg |
24033143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 166 - 253
Target Start/End: Complemental strand, 4674917 - 4674829
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||||||||||| || ||||| | ||||| ||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
4674917 |
gtcctcgtgagcatagctcagttgacagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
4674829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 11897250 - 11897314
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
11897250 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
11897314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 17545240 - 17545176
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
17545240 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
17545176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 18755988 - 18756052
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||| |||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
18755988 |
cgtgagcttaactcagttggtagagatatcgcattttatatgcaggagtcggggttcgaaccccg |
18756052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 25400434 - 25400371
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
25400434 |
gtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
25400371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 172 - 235
Target Start/End: Original strand, 27798624 - 27798687
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| ||||||||| | | |||||||||||||||| |
|
|
| T |
27798624 |
gtgagcatagctcagttggtagggatattgcatattatatgcaagagccagggttcgaaccccg |
27798687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 546804 - 546870
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||||||| ||||||||||| |||| |
|
|
| T |
546804 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaacctcgaa |
546870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 8241054 - 8241116
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
8241054 |
tgagcttagctcagttggtagggatattgcatattatatgcaagggtcggggttcgaaccccg |
8241116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 42320319 - 42320385
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| | |||||||||||||| |
|
|
| T |
42320319 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggagttcgaaccccgaa |
42320385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 237
Target Start/End: Complemental strand, 6735840 - 6735791
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6735840 |
tggtagggatatttcattttatatgcaggggtcggggttcgaaccccgaa |
6735791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 170 - 234
Target Start/End: Original strand, 2362970 - 2363034
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||| || ||||| |||||||||||| |||| |||||||||||||| ||||||||||||| |
|
|
| T |
2362970 |
tcgtgagcttaactcagttggtagggatattgcatattatatgcaggggttggggttcgaacccc |
2363034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 4417753 - 4417689
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
4417753 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
4417689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 5966831 - 5966895
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
5966831 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
5966895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 6558803 - 6558863
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
6558803 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggggtcggggttcgaac |
6558863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 8968751 - 8968815
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
8968751 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
8968815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 9835035 - 9835099
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
9835035 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
9835099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 12463758 - 12463822
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
12463758 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
12463822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 12891559 - 12891623
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| ||||| | |||||||||||||| |
|
|
| T |
12891559 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccg |
12891623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 19891498 - 19891430
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| || ||||| ||||| |||||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
19891498 |
tcctcgtgagcttaactcagttggtaaggatattgcattttatatgcaggggttggggttcgaatcccg |
19891430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 27765259 - 27765323
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
27765259 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccg |
27765323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 32505690 - 32505754
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
32505690 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
32505754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 35512024 - 35511960
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| ||||||||||||| |||||||||||| |||| | |||||||||||||| |
|
|
| T |
35512024 |
cgtgagcttaactcagttggtagggatatcacattttatatgctggggccggggttcgaaccccg |
35511960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 35515514 - 35515578
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
35515514 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
35515578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 36888463 - 36888399
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||| |||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
36888463 |
cgtgagcttagttcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
36888399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 42916391 - 42916455
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| | || ||||||||||||| | |||||||||||||| |
|
|
| T |
42916391 |
cgtgagcttagctcagttggtagggatattgtatgttatatgcaggggccggggttcgaaccccg |
42916455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 1244788 - 1244737
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
1244788 |
ttatatgcaggggtcagggttcgaaccccagacaccccacttattcacctta |
1244737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 2029189 - 2029138
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||||||||||| |
|
|
| T |
2029189 |
ttatatgcaggggtcgggattcgaaccccgaacaccccacttattcacctta |
2029138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 170 - 237
Target Start/End: Original strand, 16891347 - 16891414
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||| |||||||| |||||||||||| ||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
16891347 |
tcgtgagcttagctcagttggtagggatattgcattttatatacaggggttgaggttcgaatcccgaa |
16891414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 32158475 - 32158424
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||| | |||||||||||||||| |||||||||||||||||| |
|
|
| T |
32158475 |
ttatatgcaggggccggggttcgaaccccgaacaccccacttattcacctta |
32158424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 182 - 233
Target Start/End: Complemental strand, 33736071 - 33736020
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
33736071 |
ctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccc |
33736020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 188 - 235
Target Start/End: Original strand, 34398476 - 34398523
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34398476 |
tggtagagatatcgcattttatatgcaggagtcggggttcgaaccccg |
34398523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 41319502 - 41319455
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | |||||||||||| |
|
|
| T |
41319502 |
tggtagggatattgcattttatatgcaggggtcggagttcgaaccccg |
41319455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 253
Target Start/End: Original strand, 1463870 - 1463952
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
1463870 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
1463952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 20719740 - 20719806
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| ||| || | |||||||||||| |||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
20719740 |
cgtgagcttagatctgttggtagggatattgcattttatatgtaggggtcagagttcgaacctcgaa |
20719806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 35241398 - 35241460
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| ||| |||| |||||| ||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
35241398 |
cgtgagcttagttcagttggtagagatattgcatattatatgcaggggtcggggttcgaaccc |
35241460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 37034810 - 37034872
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||| | | | |||||||||||| |
|
|
| T |
37034810 |
tgagcttagctcaattggtagggatatcgcattttatatgcaggagccggagttcgaaccccg |
37034872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 12355822 - 12355871
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| | |||||||||||||| |
|
|
| T |
12355822 |
tggtagagatattgcattttatatgcaggggtcggagttcgaaccccgaa |
12355871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 15241398 - 15241459
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| || |||| |||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
15241398 |
cgtgagcttagctcagttgataggaatattgcatattatatgcaggggtcggggttcgaacc |
15241459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 23292485 - 23292424
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||||| | ||||||||||| |
|
|
| T |
23292485 |
cgtgagcttagctcagttggtagggatattgcatgttatatgcagggtttggggttcgaacc |
23292424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 1743129 - 1743192
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
1743129 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggag-ccgggttcgaaccccg |
1743192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 4393858 - 4393918
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| ||| |||| |||||||||| | |||||||||||||||||||| || ||||||| |
|
|
| T |
4393858 |
cgtgagcttagttcagttggtagggatgttgcattttatatgcaggggtcgggattcgaac |
4393918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 4745944 - 4745880
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| ||| | | |||||||||||||| |
|
|
| T |
4745944 |
cgtgagcttagctcagttggtagggatattgcatattatatgaaggagccggggttcgaaccccg |
4745880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 5900294 - 5900357
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
5900294 |
cgtgagcttaactcagttggtagggatattgcatattatatgcagggg-ccgggttcgaaccccg |
5900357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 6518844 - 6518780
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
6518844 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccg |
6518780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 232
Target Start/End: Complemental strand, 7147121 - 7147054
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||| |||||||||||||||| ||||| ||| || ||||| ||||||||||||||| ||||||||||| |
|
|
| T |
7147121 |
agtccccgtgagcatagctcagttggtaaggacat-gcattattatatgcaggggtcggggttcgaacc |
7147054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 10404137 - 10404193
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||||||| |||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
10404137 |
tagctcagttggtaggaatattgcatattatatgcaggagtcggggttcgaaccccg |
10404193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 209 - 257
Target Start/End: Original strand, 16263775 - 16263823
Alignment:
| Q |
209 |
tatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||| | |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
16263775 |
tatgcaggggccggggttctaaccccggattccccacttattcacctta |
16263823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 257
Target Start/End: Original strand, 19608603 - 19608698
Alignment:
| Q |
162 |
gggagtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||| | |||||||||||||| || |||| |||| ||||| ||||||||||||||| |||||||||| ||| | | ||||||||||||||| |
|
|
| T |
19608603 |
gggagtccccatgagcatagctcagttgataggaatat-gcattattatatgcaggggtcggggttcgaactccggacacttcacttattcacctta |
19608698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 247
Target Start/End: Complemental strand, 31074195 - 31074119
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||| || ||||| |||||||||||| ||||||||||| ||| | | ||||||||||||||||| | |||||| |
|
|
| T |
31074195 |
cgtgagcttaactcagttggtagggatattacattttatatgtaggagccggggttcgaaccccgaatactccactt |
31074119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 36124401 - 36124465
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| || |||| |||| |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
36124401 |
cgtgagcttagctcagttgataggaatattgcatattatatgcaggggtcggggttcgaatcccg |
36124465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 188 - 236
Target Start/End: Original strand, 37182562 - 37182610
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccga |
236 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||| ||||||||| ||||| |
|
|
| T |
37182562 |
tggtagggatatcgcatattatatgcaggagtcggggttcgaaacccga |
37182610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 37303927 - 37304015
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | | ||| ||||||||||||||| |||||||||||| | | |||||||||||||| |
|
|
| T |
37303927 |
gtccccgtgagcatagctcagttggcagggacaatgtattattatatgcaggggtcggggttcgaaccctggacaccccacttattcac |
37304015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 39886280 - 39886216
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||||||| ||| | |||||||||||||| |
|
|
| T |
39886280 |
cgtgagcatagctcagttggtagggatattgcatattatatgtaggagctggggttcgaaccccg |
39886216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 39919161 - 39919097
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||| || |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
39919161 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
39919097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 41179871 - 41179807
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | ||||||||| |||| |
|
|
| T |
41179871 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccg |
41179807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 42525410 - 42525466
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
42525410 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
42525466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 183 - 230
Target Start/End: Original strand, 1670408 - 1670455
Alignment:
| Q |
183 |
tcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
1670408 |
tcagttggtagggatatggcatattatatgcaggggtcggggttcgaa |
1670455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 2328594 - 2328657
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| ||||| || |||||||||||| |||| ||||||||||| | | ||||||||||||| |
|
|
| T |
2328594 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggggttcgaacccc |
2328657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 10241727 - 10241790
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| |||||||||||||| |||||| |||||| |
|
|
| T |
10241727 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggttggggttcaaacccc |
10241790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 218
Target Start/End: Complemental strand, 11786128 - 11786081
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
11786128 |
cgtgagcttaactcagttggtagggatattgcattttatatgcagggg |
11786081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 165 - 232
Target Start/End: Original strand, 18928716 - 18928783
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||| |||||| |||||||| |||||||||||| |||| | |||||||||||| | ||||||||| |
|
|
| T |
18928716 |
agtccttgtgagcttagctcagttggtagggatattgcataatttatgcaggggtcggtgttcgaacc |
18928783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 205 - 256
Target Start/End: Original strand, 20191474 - 20191525
Alignment:
| Q |
205 |
tttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||| |||||||||||||| | | ||||||||||||||| |
|
|
| T |
20191474 |
tttatatgcaggggtcggggttcgaaccccggacactccacttattcacctt |
20191525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 23925577 - 23925628
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||||||||| |||| || ||||||||||||| |||| |
|
|
| T |
23925577 |
ttatatgcaggggtctgggttcgaatcccggataccccacttattcatctta |
23925628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 25648153 - 25648090
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||| ||||||| | | ||||||||||||| |
|
|
| T |
25648153 |
cgtgagcttagctcagttggtagggatattgcatattacatgcaggagccggggttcgaacccc |
25648090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 28378126 - 28378075
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| |||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
28378126 |
ttatatgtaggggttggggttcgaaccccgaacaccccacttattcacctta |
28378075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 30571162 - 30571205
Alignment:
| Q |
177 |
catagctcagctggtagggatatcgcattttatatgcaggggtc |
220 |
Q |
| |
|
|||||||||| |||||||||||| |||| ||||||||||||||| |
|
|
| T |
30571162 |
catagctcagttggtagggatattgcatattatatgcaggggtc |
30571205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 36045195 - 36045148
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
36045195 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
36045148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 41843692 - 41843743
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||||||||| || || ||| |||||||||||||||||| |
|
|
| T |
41843692 |
ttatatgcaggggtcagggttcaaatcctgaaacccccacttattcacctta |
41843743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 42618510 - 42618427
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||||||| ||||| ||| ||||| | ||||| |||||| |||||||| ||||||||| |||| || |||||||||||||| |
|
|
| T |
42618510 |
cgtgagcatacctcagttggcagggacaatgcattattatatacaggggtcggggttcgaatcccggataccccacttattcac |
42618427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 257
Target Start/End: Complemental strand, 3536039 - 3535946
Alignment:
| Q |
164 |
gagtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||| || ||||| |||||| |||| | | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
3536039 |
gagtccccgtgagcatagttcagttggcagggacat-gcattgttatatacaggagccggggttcgaaccccggacaccccacttattcacctta |
3535946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 233
Target Start/End: Complemental strand, 10905196 - 10905142
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||||| || || |||||| | |||||||||||||||||| |||||||||||| |
|
|
| T |
10905196 |
tagctcagttgataaggatattgtattttatatgcaggggtcggggttcgaaccc |
10905142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 173 - 235
Target Start/End: Complemental strand, 16386807 - 16386745
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccg |
16386745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 17175108 - 17175058
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||| | ||||||||||| |
|
|
| T |
17175108 |
ctcagttggtagggatattgcatgttatatgcaggggccggggttcgaacc |
17175058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 21749445 - 21749383
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||| ||||||||||| ||| | |||||||||| |
|
|
| T |
21749445 |
cgtgagcttagctcagttggtagggatactgcatattatatgcaggagtcggtgttcgaaccc |
21749383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 21918054 - 21918116
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | |||||||||||| |
|
|
| T |
21918054 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccc |
21918116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 166 - 251
Target Start/End: Original strand, 25660906 - 25660991
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattc |
251 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||| ||||| ||||||||||||| | || |||||||||| | |||||||||||| |
|
|
| T |
25660906 |
gtccccgtgagcatagctcagttggcagggatat-gcattgttatatgcaggggccgggattcgaaccccagacaccccacttattc |
25660991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 256
Target Start/End: Original strand, 31556852 - 31556902
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||||| | |||||||||||| | ||||||||||||||||| |
|
|
| T |
31556852 |
ttatatgcaggggtcggagttcgaaccccggacaccccacttattcacctt |
31556902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 256
Target Start/End: Original strand, 31907685 - 31907735
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||| ||||| |||| |||| ||||||||||||||||| |
|
|
| T |
31907685 |
ttatatgcaggggtcatggttcaaacctcgaacaccccacttattcacctt |
31907735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 173 - 235
Target Start/End: Complemental strand, 36716924 - 36716862
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| || |||||||||||||||||| |||| |||||||||||| | ||||| |||||||| |
|
|
| T |
36716924 |
tgagcttaactcagctggtagggatattgcatattatatgcagggaccggggtttgaaccccg |
36716862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 235
Target Start/End: Original strand, 3198324 - 3198393
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||| || |||| ||||||||||||| ||||||||||||| |
|
|
| T |
3198324 |
gtccccgtgagcttagctcagttggtagggacattgcataatatatgcaggggttgaggttcgaaccccg |
3198393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 230
Target Start/End: Original strand, 6414068 - 6414128
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
||||||||| || ||||| |||||||||||| |||| ||||||||| ||||| ||||||||| |
|
|
| T |
6414068 |
ctcgtgagcttaactcagttggtagggatattgcatattatatgca-gggtcggggttcgaa |
6414128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 233
Target Start/End: Complemental strand, 11954322 - 11954261
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||| ||| |||||||||| ||||| |||| ||||||| | |||||||||||||||||| |
|
|
| T |
11954322 |
gtgagcttagttcagctggtatagatattgcatattatatgtatgggtcagggttcgaaccc |
11954261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 238
Target Start/End: Original strand, 18473827 - 18473876
Alignment:
| Q |
189 |
ggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaat |
238 |
Q |
| |
|
||||||||||| | || |||||||||||||||||| ||| |||||||||| |
|
|
| T |
18473827 |
ggtagggatattgtatattatatgcaggggtcaggattctaaccccgaat |
18473876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 257
Target Start/End: Original strand, 18478000 - 18478088
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||||| ||||||| || ||||| |||||||| |||| | |||||||||||| | | |||||||||||||||||| |
|
|
| T |
18478000 |
ctcgtgagcatagctcagttggtaggacaat-gcattattatatgctggggccggggttcgaaccctggacaccccacttattcacctta |
18478088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 32226305 - 32226252
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||| ||||| | |||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
32226305 |
tagctcagatggtatgaatattgcatattatatgcaggggtcggggttcgaacc |
32226252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 2848215 - 2848279
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| | || ||||||||| | | | |||||||||||||| |
|
|
| T |
2848215 |
cgtgagcttagctcagttggtagggatattgtatattatatgcatgaggcggggttcgaaccccg |
2848279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 203 - 235
Target Start/End: Original strand, 3740988 - 3741020
Alignment:
| Q |
203 |
attttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
3740988 |
attttatatgcaggggtcggggttcgaaccccg |
3741020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 183 - 235
Target Start/End: Complemental strand, 4238364 - 4238312
Alignment:
| Q |
183 |
tcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| ||||| |||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
4238364 |
tcagttggtatggatattgcatattatatgcaggggccggggttcgaaccccg |
4238312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 220
Target Start/End: Original strand, 6119866 - 6119914
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtc |
220 |
Q |
| |
|
|||||| |||||||| ||| |||||||| ||||||||||||||| |||| |
|
|
| T |
6119866 |
gtgagcttagctcagttggaagggatattgcattttatatgcagaggtc |
6119914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 253
Target Start/End: Complemental strand, 6806742 - 6806654
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| || || | ||||| ||||||||||||||| || ||||||||||| | | |||||||||||| |
|
|
| T |
6806742 |
gtccccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcgggattcgaaccccggacactccacttattcac |
6806654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 7263993 - 7264044
Alignment:
| Q |
164 |
gagtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcag |
215 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
7263993 |
gagtccccgtgagcatagctcagctgatagggatat-gcattattatatgcag |
7264044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 9125665 - 9125728
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||| ||||| |||| ||||||||| ||| | |||||||||||||| |
|
|
| T |
9125665 |
cgtgagcttagctcagttggtagcgatattgcatattatatgca-gggccggggttcgaaccccg |
9125728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 257
Target Start/End: Original strand, 9963409 - 9963501
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| |||||| ||||||||| ||| ||||| | ||||| |||||||||||||| |||||||||| || | |||||||||||||||||| |
|
|
| T |
9963409 |
gtccccgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggttggggttcgaacttcggaccccccacttattcacctta |
9963501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 11774519 - 11774463
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| | |||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
11774519 |
tagctcagtttgtagggatattgcatattatatgcaggagccggggttcgaaccccg |
11774463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 12767966 - 12768030
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||| |||| |||||||||||| |||| ||||||||||| | | | |||||||||||| |
|
|
| T |
12767966 |
cgtgagcttagttcagttggtagggatattgcatattatatgcaggagccggcgttcgaaccccg |
12768030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 14624295 - 14624339
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||||||||| ||||||||||||||||| | |||||| |||| |
|
|
| T |
14624295 |
tggtagggatatcacattttatatgcaggggccggggttctaacc |
14624339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 14641177 - 14641113
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || |||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
14641177 |
cgtgagcttaactcaattggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
14641113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 16603400 - 16603444
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcag |
215 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||| |
|
|
| T |
16603400 |
cgtgagcttagctcagttggtagggatattgcatattatatgcag |
16603444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 207 - 235
Target Start/End: Original strand, 20224143 - 20224171
Alignment:
| Q |
207 |
tatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20224143 |
tatatgcaggggtcagggttcgaaccccg |
20224171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 22229022 - 22228970
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||| ||||| |||||| |||| ||||||||||||||| | |||||||| |
|
|
| T |
22229022 |
tagctcagttggtatggatattgcatgttatatgcaggggtcggagttcgaac |
22228970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 209 - 257
Target Start/End: Complemental strand, 24397988 - 24397940
Alignment:
| Q |
209 |
tatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||| || ||||||||||||||| |||||||||||||||||| |
|
|
| T |
24397988 |
tatgcagggttcggggttcgaaccccgatcaccccacttattcacctta |
24397940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 25472651 - 25472607
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcag |
215 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||| |
|
|
| T |
25472651 |
cgtgagcttagctcagttggtagggatattgcatattatatgcag |
25472607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 32565518 - 32565550
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggata |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
32565518 |
gtcctcgtgagcttagctcagctggtagggata |
32565550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 34389672 - 34389617
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||||| ||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
34389672 |
tagctcagttggtaaagatattgcattttatatgcagggg-ccgggttcgaaccccg |
34389617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 256
Target Start/End: Original strand, 34729492 - 34729555
Alignment:
| Q |
192 |
agggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||| |||| ||||||||||||||| ||||||||| |||| | ||||||||||||||||| |
|
|
| T |
34729492 |
agggataatgcatattatatgcaggggtcggggttcgaa-cccggacaccccacttattcacctt |
34729555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 35113030 - 35112970
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| ||| |||| || ||||||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
35113030 |
cgtgagcttagttcagttgatagggatattgcatattatatgcaggggttggggttcgaac |
35112970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 225 - 257
Target Start/End: Original strand, 36635378 - 36635410
Alignment:
| Q |
225 |
ttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
36635378 |
ttcgaactccgaattccccacttattcacctta |
36635410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 40361639 - 40361587
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||| |||| |||||||||| |
|
|
| T |
40361639 |
tagctcagttggtagggatattgcatattatatgcaagggttggggttcgaac |
40361587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 41930118 - 41930170
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| || ||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
41930118 |
ctcagttgatagggatattgcattttatatgcaggggctggggttcgaacccc |
41930170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 43580888 - 43580944
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | ||||||||| |||| |
|
|
| T |
43580888 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccg |
43580944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 6e-19; HSPs: 137)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 8265270 - 8265334
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
8265270 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcagggttcgaaccccg |
8265334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 44673716 - 44673653
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
44673716 |
cgtgagcttagctcagttggtagggatatcacattttatatgcaggggtcggggttcgaacccc |
44673653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 167 - 232
Target Start/End: Complemental strand, 9070797 - 9070732
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||||||| || ||||| | ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9070797 |
tcctcgtgagcttaactcagttagtagggatatcgcattttatatgtaggggtcagggttcgaacc |
9070732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 257541 - 257605
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
257541 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccg |
257605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 658379 - 658315
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
658379 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccg |
658315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 844115 - 844051
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
844115 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccg |
844051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 38219636 - 38219572
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
38219636 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
38219572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 36540289 - 36540352
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
36540289 |
cgtgagcttaactcagttggtagggatattgcattttatatgcaggggtcggggttcgaacccc |
36540352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 8402404 - 8402318
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| ||||||| ||||||||| || |||| ||||||||| || | ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8402404 |
cgtgagcttagctcaattggtagggacattgcataatatatgcagcggccggggttcgtaccccgaattccccacttattcacctta |
8402318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 7453362 - 7453418
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||| | |||||||||||||| |
|
|
| T |
7453362 |
tagctcagctggtagggatattgcattttatatgtaggggccggggttcgaaccccg |
7453418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 23178959 - 23178895
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
23178959 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
23178895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 167 - 235
Target Start/End: Original strand, 23261299 - 23261367
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||||| |||||||||| | |||||||||||||| |
|
|
| T |
23261299 |
tcctcgtgagcttagctgagttggtagggatatcgcatttcatatgcagggaccggggttcgaaccccg |
23261367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 43085291 - 43085227
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||| ||||||||| ||||||||||||||||| | |||||||||||||| |
|
|
| T |
43085291 |
cgtgagcttagctcagttgggagggatatcacattttatatgcaggggccggggttcgaaccccg |
43085227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 43856450 - 43856386
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
43856450 |
cgtgagcttaactcagttggtagggatattgcattttatatgcaggggccggggttcgaaccccg |
43856386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 172 - 231
Target Start/End: Complemental strand, 8862193 - 8862134
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||| ||||| || |||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
8862193 |
gtgagcttagctaagttggtagggatattgcatattatatgcaggggtcagggttcgaac |
8862134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 9187291 - 9187228
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||||||| |||||| ||||||||||||| |
|
|
| T |
9187291 |
cgtgagcttagctcagttggtagggatattacattttatatgctggggtcggggttcgaacccc |
9187228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 188 - 235
Target Start/End: Original strand, 9370187 - 9370234
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
9370187 |
tggtagggatattgcatattatatgcaggggtcagggttcgaaccccg |
9370234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 16449127 - 16449190
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||||||| ||||||||||||| |
|
|
| T |
16449127 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaacccc |
16449190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 26022249 - 26022312
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | ||||||||||||| |
|
|
| T |
26022249 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacccc |
26022312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 27077164 - 27077101
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
27077164 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaatcccg |
27077101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 12293 - 12231
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||||||||||| ||| ||||| |
|
|
| T |
12293 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcaggtttctaaccc |
12231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 179 - 237
Target Start/End: Original strand, 10573111 - 10573169
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
10573111 |
tagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccgaa |
10573169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 171 - 256
Target Start/End: Complemental strand, 220458 - 220373
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||| ||| ||||| || || |||||||||| |||||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
220458 |
cgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcacctt |
220373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 171 - 256
Target Start/End: Complemental strand, 689613 - 689528
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||| ||| ||||| || || |||||||||| |||||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
689613 |
cgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcacctt |
689528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 171 - 256
Target Start/End: Complemental strand, 734081 - 733996
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||| ||| ||||| || || |||||||||| |||||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
734081 |
cgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcacctt |
733996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 171 - 256
Target Start/End: Complemental strand, 857977 - 857892
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||| ||| ||||| || || |||||||||| |||||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
857977 |
cgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcacctt |
857892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 253
Target Start/End: Original strand, 2800011 - 2800100
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
2800011 |
agtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
2800100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 170 - 235
Target Start/End: Complemental strand, 26192785 - 26192720
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||| |||| |||||||||||| |||| |||||||||| |||| |||||||||||||| |
|
|
| T |
26192785 |
tcgtgagcttagttcagttggtagggatattgcatattatatgcagaggtcggggttcgaaccccg |
26192720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 40362050 - 40362111
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| | |||||||||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
40362050 |
cgtgagcttagctcagttagtagggatattgcatattatatgcaggggtcggggttcgaacc |
40362111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 43656038 - 43656099
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| ||||||| ||||||||||| |
|
|
| T |
43656038 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggtcggggttcgaacc |
43656099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 1937312 - 1937376
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
1937312 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccg |
1937376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 2787149 - 2787085
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
2787149 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
2787085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 2792781 - 2792845
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
2792781 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccggggttcgaaccccg |
2792845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 5328627 - 5328571
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
5328627 |
tagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
5328571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 5570896 - 5570960
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||| ||||||| |||| ||||||||||||||| | |||||||||||| |
|
|
| T |
5570896 |
cgtgagcttagctcagttggttgggatattgcatgttatatgcaggggtcggagttcgaaccccg |
5570960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 8953941 - 8953873
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| || | ||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
8953941 |
tcctcgtgagcttaacacagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
8953873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 10083165 - 10083229
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
10083165 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcgaggttcgaaccccg |
10083229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 10200753 - 10200685
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| |||||||| |||||| ||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
10200753 |
tcctcgtgagcttagctcagttggtagagatattgcatattatatgcaggagccggggttcgaaccccg |
10200685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 10736942 - 10736878
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
10736942 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
10736878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 247
Target Start/End: Complemental strand, 17072631 - 17072555
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||| |||| ||| ||||||| |||| |||| ||||||||||||| | |||||||||||||||| |||||||| |
|
|
| T |
17072631 |
cgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccactt |
17072555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 247
Target Start/End: Original strand, 17575640 - 17575716
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||| |||| ||| ||||||| |||| |||| ||||||||||||| | |||||||||||||||| |||||||| |
|
|
| T |
17575640 |
cgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccactt |
17575716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 29260621 - 29260685
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || |||||||||||||||||| |||| ||||||||||| ||| ||| |||||||||| |
|
|
| T |
29260621 |
cgtgagcttaactcagctggtagggatattgcatattatatgcaggagtcggggctcgaaccccg |
29260685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 29716862 - 29716926
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
29716862 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
29716926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 33473415 - 33473359
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||| || ||||||||| |||| |
|
|
| T |
33473415 |
tagctcagttggtagggatatcacattttatatgcagggatcggggttcgaatcccg |
33473359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 33617974 - 33618038
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||||||| | |||||||||||| |
|
|
| T |
33617974 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggtgttcgaaccccg |
33618038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 34158725 - 34158661
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
34158725 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccg |
34158661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 34413064 - 34413128
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
34413064 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
34413128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 34894379 - 34894435
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
34894379 |
tagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
34894435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 41616434 - 41616370
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||| ||||| |||||||||||| | || ||||||||||||| | |||||||||||||| |
|
|
| T |
41616434 |
cgtgagcataactcagttggtagggatattgtatattatatgcaggggccggggttcgaaccccg |
41616370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 15042461 - 15042375
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||||||||||||| | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
15042461 |
cgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
15042375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 256
Target Start/End: Original strand, 17467272 - 17467361
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||| ||||||||| ||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| | ||||||||||||||||| |
|
|
| T |
17467272 |
gtccttgtgagcataactcagttggtagggatata-cattattatatgcaggggcc-gggttcgaaccccggacaccccacttattcacctt |
17467361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 179 - 238
Target Start/End: Original strand, 37092101 - 37092160
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaat |
238 |
Q |
| |
|
|||||||| |||||||||||| | || |||||||| |||| ||||||||||||||||||| |
|
|
| T |
37092101 |
tagctcagttggtagggatattgtatattatatgctggggccagggttcgaaccccgaat |
37092160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 38745347 - 38745284
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcat-tttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||| ||| |||||||||||||| |
|
|
| T |
38745347 |
cgtgagcttagctcagttggtagggatattgcatatttatatgcatgggccagggttcgaaccc |
38745284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 133417 - 133483
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||| ||||||||||| ||| |||||||||| ||||| |
|
|
| T |
133417 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggagtcggggttcgaactccgaa |
133483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 256
Target Start/End: Complemental strand, 4798637 - 4798552
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||| ||||||||| ||||||| ||| ||||| ||||||||||||| | |||||||||||||| | ||||||||||||||||| |
|
|
| T |
4798637 |
cgtgagtatagctcagttggtagg-ataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
4798552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 8698648 - 8698566
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| |||||| ||||||||| |||| | |||||||| ||||| |
|
|
| T |
8698648 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggttggggttcgaatcccggacaccccacttcttcac |
8698566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 257
Target Start/End: Original strand, 10970266 - 10970351
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||| ||||||||||||| |||||| ||||||||| |||||||||||||||||| |
|
|
| T |
10970266 |
gtgagcatagctcagttggtagg-ataatgcattattatatgcaggggctggggttcaaaccccgaacaccccacttattcacctta |
10970351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 23858199 - 23858261
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | | |||||||||| |
|
|
| T |
23858199 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggagttcgaaccc |
23858261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 24296936 - 24296874
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| | |||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
24296936 |
cgtgagcttagctcagttagtagggatattgcatattatatgcaggggttggggttcgaaccc |
24296874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 26280852 - 26280786
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| || ||||| |||||||||||| ||||||||||||| || | | |||||||||||||||| |
|
|
| T |
26280852 |
cgtgagcttaactcagttggtagggatattgcattttatatgccggagccggggttcgaaccccgaa |
26280786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 39587549 - 39587611
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||| ||||| ||||||||||| |||||||| || ||||||||| |
|
|
| T |
39587549 |
cgtgagcttagctcagttggtagagatattgcattttatattcaggggtcgggattcgaaccc |
39587611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 234
Target Start/End: Complemental strand, 41865149 - 41865087
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||| |||||||| |||| | ||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
41865149 |
gtgagcttagctcagttggtggagatattacatattatatgcaggggtcagggttcgaacccc |
41865087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 3190017 - 3189955
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| ||||||||||| |||||||||||| |||| ||||||||| |||| |||||||||||||| |
|
|
| T |
3190017 |
cgtgtgcatagctcagttggtagggatattgcatattatatgca--ggtcggggttcgaaccccg |
3189955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 18926195 - 18926139
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcaggg-ttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
18926195 |
tagctcaattggtagggatatcgcattttatatgcagggg-cagggattcgaaccccg |
18926139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 35939489 - 35939550
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||| |||| |
|
|
| T |
35939489 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcaaacc |
35939550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 169 - 249
Target Start/End: Original strand, 43847699 - 43847779
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttat |
249 |
Q |
| |
|
|||||||||||||||||| ||||||| || ||||| ||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
43847699 |
ctcgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggccggggttcgaaccccgaacaccccacttat |
43847779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 94579 - 94515
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | | |||||||||||| |
|
|
| T |
94579 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccg |
94515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 2696526 - 2696614
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||| ||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
2696526 |
gtccccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
2696614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 5326238 - 5326174
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||| ||||| ||||||||||||||| || | | |||||||||||| |
|
|
| T |
5326238 |
cgtgagcttagctcagttggtagagatattgcattttatatgcagaggccggtgttcgaaccccg |
5326174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 6280482 - 6280546
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| | || ||||||||||| | | |||||||||||||| |
|
|
| T |
6280482 |
cgtgagcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccg |
6280546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 6659299 - 6659355
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
6659299 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
6659355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 6739701 - 6739757
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
6739701 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
6739757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 8034480 - 8034420
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||||| | |||||||||| |
|
|
| T |
8034480 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggccggggttcgaac |
8034420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 205 - 253
Target Start/End: Complemental strand, 10309722 - 10309674
Alignment:
| Q |
205 |
tttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
10309722 |
tttatatgcaggggtcggggttcaaaccccgaacaccccacttattcac |
10309674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 10594284 - 10594220
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||| | || |||||||||||| |||||||||||||||| | | |||||||||||||| |
|
|
| T |
10594284 |
cgtgagcttagtttagttggtagggatattgcattttatatgcaggagccggggttcgaaccccg |
10594220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 11875888 - 11875952
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
11875888 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccg |
11875952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 11890895 - 11890959
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
11890895 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccg |
11890959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 258
Target Start/End: Complemental strand, 13762573 - 13762521
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcaccttac |
258 |
Q |
| |
|
||||||||||||||||| ||||||||| || | ||||||||||||||||||| |
|
|
| T |
13762573 |
ttatatgcaggggtcagtgttcgaaccacggacaccccacttattcaccttac |
13762521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 17698524 - 17698588
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | ||||||||| |||| |
|
|
| T |
17698524 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccg |
17698588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 22274671 - 22274615
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
22274671 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
22274615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 24458319 - 24458383
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||| |||||||| | || ||||||||||||| | |||||||||||||| |
|
|
| T |
24458319 |
cgtgagcttagctcagttggaagggatattgtatattatatgcaggggccggggttcgaaccccg |
24458383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 26567316 - 26567252
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||| ||||||||||| ||| || ||||||||||| |
|
|
| T |
26567316 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggagtcgggattcgaaccccg |
26567252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 28420496 - 28420428
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| |||||||| ||||||| |||| |||| |||||||| || | | |||||||||||||| |
|
|
| T |
28420496 |
tcctcgtgagcttagctcagttggtaggaatattgcatattatatgctggagccggggttcgaaccccg |
28420428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 28909467 - 28909531
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||| ||||||| | | |||||||||||||| |
|
|
| T |
28909467 |
cgtgagcttagctcagttggtagggatattgcatattacatgcaggagccggggttcgaaccccg |
28909531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 37535559 - 37535503
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
37535559 |
tagctcaattggtagggatattgcatattatatgcagaagtcagggttcgaaccccg |
37535503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 37717365 - 37717429
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
37717365 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
37717429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 37838587 - 37838643
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||||||| |||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
37838587 |
tagctcaaatggtagggatattgcatattatatgcaggggccagagttcgaaccccg |
37838643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 38955262 - 38955198
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| ||| ||||||||||||| | |||||||||||||| |
|
|
| T |
38955262 |
cgtgagcttaactcagttggtagggatattacatattatatgcaggggccggggttcgaaccccg |
38955198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 227
Target Start/End: Original strand, 40094887 - 40094943
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttc |
227 |
Q |
| |
|
||||||| |||||||| || || |||||| |||||||||||||||||||| |||||| |
|
|
| T |
40094887 |
cgtgagcttagctcagttgataaggatattgcattttatatgcaggggtcggggttc |
40094943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 43186863 - 43186919
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | |||| ||||||||||| |
|
|
| T |
43186863 |
tagctcagttggtagggatattgcatattatatgcaggagccaggattcgaaccccg |
43186919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 43284026 - 43283970
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
43284026 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
43283970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 43980381 - 43980317
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||| |||| || ||||||||| |||| |||||||||||| || |||||||||||||| |
|
|
| T |
43980381 |
cgtgagcttagttcagttgttagggatattgcatattatatgcagggatcggggttcgaaccccg |
43980317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 205 - 257
Target Start/End: Complemental strand, 44923359 - 44923307
Alignment:
| Q |
205 |
tttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| |||||||||||||| | |||||| ||||||| |||| |
|
|
| T |
44923359 |
tttatatgcaggggtcggggttcgaaccccggactccccatttattcatctta |
44923307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 1632507 - 1632444
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| ||||||| |||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
1632507 |
gtgagcttagctcagttggtaggaatattacatattatatgcaggagtcggggttcgaaccccg |
1632444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 8034564 - 8034615
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||| | | |||||||||||||||| |||||||||||||||||| |
|
|
| T |
8034564 |
ttatatgcaggagccggggttcgaaccccgaacaccccacttattcacctta |
8034615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 10199803 - 10199752
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||| | ||||||||||||| || |||||||||||||||||| |
|
|
| T |
10199803 |
ttatatgcaggggccggggttcgaaccccaaacaccccacttattcacctta |
10199752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 22487885 - 22487940
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| |||| |||| |||||||| |
|
|
| T |
22487885 |
tagctcagttggtagggatattgcattttatatgcaagggttggggtacgaacccc |
22487940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 23435300 - 23435237
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| || ||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
23435300 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaaccccg |
23435237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 25139948 - 25139897
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||| |||| |
|
|
| T |
25139948 |
ttatatgcaggggtcggggttcgaaccccgaacatcccacttattcatctta |
25139897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 29729132 - 29729183
Alignment:
| Q |
183 |
tcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||| |||||||||||| |||| |||||| ||||||| |||||||||||||| |
|
|
| T |
29729132 |
tcagttggtagggatattgcatattatatacaggggttagggttcgaacccc |
29729183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 30942660 - 30942609
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||| | |||||||||||||||| ||||||||||| |||||| |
|
|
| T |
30942660 |
ttatatgcaggggccggggttcgaaccccgaacaccccacttatttacctta |
30942609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 34073300 - 34073249
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| |||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
34073300 |
ttatatgtaggggtcaaggttcgaaccccggacaccccacttattcacctta |
34073249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 34472299 - 34472362
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| || ||||||||||||| |
|
|
| T |
34472299 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagttggggttcgaacccc |
34472362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 39362267 - 39362330
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||| ||| | ||||||||||| |
|
|
| T |
39362267 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagaggttggagttcgaacccc |
39362330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 218
Target Start/End: Original strand, 41689884 - 41689931
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
41689884 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggg |
41689931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 247
Target Start/End: Original strand, 42006781 - 42006856
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||| ||||||||||| | | ||||||||||| |||| | |||||| |
|
|
| T |
42006781 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccgtggttcgaaccctgaatactccactt |
42006856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 43468801 - 43468715
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||||||| ||||||| |||||||||| ||| | |||||||||||||||||| |
|
|
| T |
43468801 |
cgtgagcatagctcagttggtaggacaat-gcattgttatatgtaggggtcggggttcgaactccggacaccccacttattcacctta |
43468715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 7194266 - 7194328
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| ||| |||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
7194328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 17027948 - 17027886
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||| || | | |||||||||||| |
|
|
| T |
17027948 |
cgtgagcttagctcagttggtagggatattgcatattatatgccggagccggggttcgaaccc |
17027886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 17558384 - 17558322
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||| || | | |||||||||||| |
|
|
| T |
17558384 |
cgtgagcttagctcagttggtagggatattgcatattatatgccggagccggggttcgaaccc |
17558322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 256
Target Start/End: Original strand, 26657856 - 26657941
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaacccc-gaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||| |||||||||||| | ||||||||||||| || ||||||||||||||||| |
|
|
| T |
26657856 |
gtgagcatagctcagttggtagggacat-gcattgttatatgcagggaccggggttcgaaccccagacacccccacttattcacctt |
26657941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 217
Target Start/End: Complemental strand, 32719675 - 32719629
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggg |
217 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
32719675 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
32719629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 174 - 232
Target Start/End: Original strand, 34266017 - 34266075
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||| |||||||| |||||||||||| |||| ||||||||||| || ||||||||||| |
|
|
| T |
34266017 |
gagcttagctcagttggtagggatattgcatattatatgcaggagttggggttcgaacc |
34266075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 166 - 235
Target Start/End: Original strand, 37708687 - 37708757
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatc-gcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| ||||||| ||||||| ||||||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
37708687 |
gtccccgtgagcttagctcaattggtagggataagtgcattttatatgcaggggccggggttcgaaccccg |
37708757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 4654176 - 4654115
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||||| || ||||||||| |||| ||||||||| ||| || |||||||||||| |
|
|
| T |
4654176 |
tgagcttagctcagttgctagggatattgcatattatatgcaagggccaaggttcgaacccc |
4654115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 215
Target Start/End: Original strand, 13591832 - 13591865
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcag |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
13591832 |
ctcagttggtagggatatcgcattttatatgcag |
13591865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 14876670 - 14876609
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| ||||||||| || |||| ||||||||||| | | ||||||||||| |
|
|
| T |
14876670 |
cgtgagcttagctcagttggtagggaaattgcatattatatgcaggagccggggttcgaacc |
14876609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 234
Target Start/End: Original strand, 38344049 - 38344114
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||||| || ||||| |||||||||||| |||| ||||||||||| | ||||||||||||| |
|
|
| T |
38344049 |
ctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagctggggttcgaacccc |
38344114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 237
Target Start/End: Complemental strand, 38620408 - 38620343
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||| |||||||| |||||||||||| | || ||||||||||| | | || ||||||||||||| |
|
|
| T |
38620408 |
gtgagcttagctcagttggtagggatattgtatattatatgcaggagccgggattcgaaccccgaa |
38620343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 218
Target Start/End: Original strand, 41458295 - 41458344
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
||||||||| || ||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
41458295 |
ctcgtgagcttaactcagttggtagggatattgcatattatatgcagggg |
41458344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 257
Target Start/End: Original strand, 42688053 - 42688141
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||| |||| ||||||| || ||||| ||||||| ||||||| || ||||||||||||| ||||||||||| |||||| |
|
|
| T |
42688053 |
ctcgtgagcatagttcagttggtaggacaat-gcattattatatgtaggggtcgggattcgaaccccgaacaccccacttatttacctta |
42688141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 235
Target Start/End: Original strand, 44444557 - 44444610
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
44444557 |
ctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccg |
44444610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 209 - 257
Target Start/End: Original strand, 3311477 - 3311525
Alignment:
| Q |
209 |
tatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||| ||||||||||||||||| | ||||||||||||| |||| |
|
|
| T |
3311477 |
tatgcagggatcagggttcgaaccccggacaccccacttattcatctta |
3311525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 7797140 - 7797196
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| | || ||||||||||| | | |||||||||||||| |
|
|
| T |
7797140 |
tagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccg |
7797196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 234
Target Start/End: Original strand, 12736186 - 12736254
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||| |||||||| ||||| ||| | ||| ||||||||||||||| ||||||||||||| |
|
|
| T |
12736186 |
gtccttgtgagcttagctcagttggtaaggacgttacatattatatgcaggggtcggggttcgaacccc |
12736254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 13647517 - 13647461
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||| ||||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
13647517 |
tagctcagttggtagagatattgcatattatatgcaggagtcgtggttcgaaccccg |
13647461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 13747942 - 13747886
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||| ||||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
13747942 |
tagctcagttggtagagatattgcatattatatgcaggagtcgtggttcgaaccccg |
13747886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 16432188 - 16432136
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||| |
|
|
| T |
16432188 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaac |
16432136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 256
Target Start/End: Complemental strand, 19957396 - 19957332
Alignment:
| Q |
192 |
agggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||| |||| ||||||||||||| | ||||||||||||| | ||||||||||||||||| |
|
|
| T |
19957396 |
agggataatgcatattatatgcaggggacgaggttcgaaccccggacaccccacttattcacctt |
19957332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 170 - 257
Target Start/End: Complemental strand, 26703987 - 26703900
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||| ||||| ||||||| || ||||| ||||||||| ||||| ||||||||| |||||| || ||||||||||||||| |
|
|
| T |
26703987 |
tcgtgagcataactcagttggtaggacaat-gcattattatatgcaagggtcggggttcgaatcccgaacacctcacttattcacctta |
26703900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 233
Target Start/End: Complemental strand, 31153065 - 31153025
Alignment:
| Q |
193 |
gggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||| ||||||| |||||||||||||||||||| |
|
|
| T |
31153065 |
gggatattgcatattatatgtaggggtcagggttcgaaccc |
31153025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 31451025 - 31450965
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| | | |||||||||| |
|
|
| T |
31451025 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaac |
31450965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 37090670 - 37090618
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||||||||| | || ||||||||||| ||| ||||||||||||| |
|
|
| T |
37090670 |
ctcagttggtagggatattgtatattatatgcaggagtcggggttcgaacccc |
37090618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 38402253 - 38402317
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| |||| ||||||||| |||||| ||||||| |
|
|
| T |
38402253 |
cgtgagcttaactcagttggtagggatattgcatattatttgcaggggttggggttcaaaccccg |
38402317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 38774073 - 38774133
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| |||| || |||| ||||||| ||||||||||||||||| || |||||||||| |
|
|
| T |
38774073 |
cgtgagcgtagcatagttggtggggatattgcattttatatgcagggatcggggttcgaac |
38774133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 42880950 - 42881014
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||| ||| | | |||||||||||||| |
|
|
| T |
42880950 |
cgtgagcttaactcagttggtagggatattgcatattatatgtaggagccggggttcgaaccccg |
42881014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 44340413 - 44340349
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||| |||| ||| || ||||||||||| |
|
|
| T |
44340413 |
cgtgagcttagctcagttggtagggatattgcatattataaacaggagtcgggattcgaaccccg |
44340349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 6e-19; HSPs: 105)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 35683195 - 35683135
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35683195 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaac |
35683135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 35815840 - 35815899
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35815840 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaa |
35815899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 235
Target Start/End: Original strand, 12772113 - 12772181
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
12772113 |
tcctcgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
12772181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 166 - 256
Target Start/End: Original strand, 1649146 - 1649236
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| ||||| || |||||||||| |||||||||||||| | | ||||||||||||||||| |
|
|
| T |
1649146 |
gtccccgtgagcatagctcagttggtagggatat-gcattgttttatgcaggggccagggttcgaaccctggacaccccacttattcacctt |
1649236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 24188472 - 24188535
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
24188472 |
cgtgagcatagctcagttggtagggatactgcatattatatgcaggggtcggggttcgaacccc |
24188535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 41084041 - 41084104
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
41084041 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaacccc |
41084104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 48447747 - 48447814
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||||||| || ||||| |||||| |||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
48447747 |
tcctcgtgagcttaactcagttggtagagatatcgcattttatatgcaggggccggggttcgaacccc |
48447814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 19828136 - 19828190
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
19828136 |
tagctcagttggtagggatatcgcattttatatgcagaggtcggggttcgaaccc |
19828190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 257
Target Start/End: Complemental strand, 21285456 - 21285363
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
21285456 |
agtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
21285363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 169 - 234
Target Start/End: Complemental strand, 30388577 - 30388512
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||| ||||||||||||| | ||||||||||||| |
|
|
| T |
30388577 |
ctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacccc |
30388512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 174 - 235
Target Start/End: Complemental strand, 41913829 - 41913768
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| |||||||| || ||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41913829 |
gagcttagctcagttgatagagatattgcattttatatgcaggggtcagggttcgaaccccg |
41913768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 2681098 - 2681162
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
2681098 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
2681162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 9712266 - 9712202
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
9712266 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccg |
9712202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 9877335 - 9877271
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
9877335 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
9877271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 15238891 - 15238955
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
15238891 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
15238955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 23102626 - 23102562
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
23102626 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
23102562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 32074463 - 32074399
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
32074463 |
cgtgagcttagctcagttggtagggatatcacattttatatgcaggggctggggttcgaaccccg |
32074399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 35950130 - 35950194
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
35950130 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
35950194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 36391972 - 36391908
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
36391972 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
36391908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 41465844 - 41465896
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
41465844 |
tagctcagttggtagggatattgcatattatatgcaggggtcagggttcgaac |
41465896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 11808037 - 11808123
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| ||||||| ||||||||| || ||||| ||||||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
11808037 |
cgtgagcttagctcaattggtagggacat-gcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctta |
11808123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 172 - 235
Target Start/End: Original strand, 48119473 - 48119536
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||||||||||||||||| | ||||||||||||| |
|
|
| T |
48119473 |
gtgagcttagctcagttggtagggatattgcattttatatgcaggggccgaggttcgaaccccg |
48119536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 19753036 - 19752974
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||| |
|
|
| T |
19753036 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccc |
19752974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 206 - 256
Target Start/End: Original strand, 24427397 - 24427447
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||| ||||||||||| |
|
|
| T |
24427397 |
ttatatgcaggggtcaaggttcgaaccccgaataccccatttattcacctt |
24427447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 33996949 - 33996887
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||| ||||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||| |
|
|
| T |
33996949 |
cgtgagtatagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccc |
33996887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 247
Target Start/End: Original strand, 10690857 - 10690925
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||||||| ||||||||| |||| ||||||||||||||| | ||||||||||| || |||||||| |
|
|
| T |
10690857 |
tagctcagctgatagggatattgcatattatatgcaggggtcggagttcgaaccccaaacaccccactt |
10690925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 11745197 - 11745253
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
11745197 |
tagctcagttggtagagatattgcattttatatgcaggggtcgggggtcgaaccccg |
11745253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 173 - 257
Target Start/End: Original strand, 12475630 - 12475714
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||| | |||| |||| ||||||| |||||||||||||| ||| || || |||| ||| ||||||||||||||||| |
|
|
| T |
12475630 |
tgagcatagctcggttggtcgggacatcgcataatatatgcaggggtcgggggtcaaatcccggatttcccacttattcacctta |
12475714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 166 - 253
Target Start/End: Complemental strand, 14818467 - 14818379
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||||| |||||| |||||| || |||||||||||||| |
|
|
| T |
14818467 |
gtccccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttattcac |
14818379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 166 - 253
Target Start/End: Complemental strand, 15265465 - 15265377
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||||| |||||| |||||| || |||||||||||||| |
|
|
| T |
15265465 |
gtccccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttattcac |
15265377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 24781032 - 24781096
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
24781032 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
24781096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 28444150 - 28444086
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||| |||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
28444150 |
cgtgagcttaactcagttggtagagatatcgcattttatatgcaggggccgaggttcgaaccccg |
28444086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 29617407 - 29617471
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
29617407 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
29617471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 30806125 - 30806181
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||||| | |||||||||||| |
|
|
| T |
30806125 |
tagctcagttggtagggatattgcatattatatgcaggggtcggagttcgaaccccg |
30806181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 31026221 - 31026285
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
31026221 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
31026285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 36174392 - 36174456
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
36174392 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
36174456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 172 - 232
Target Start/End: Original strand, 38151347 - 38151407
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||| |||||||| |||||||||||| ||||| | |||||||||||| ||||||||||| |
|
|
| T |
38151347 |
gtgagcttagctcagttggtagggatattgcattatttatgcaggggtcggggttcgaacc |
38151407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 38824693 - 38824629
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| || ||||||||| || | |||||||||||||||| ||||||||||||| |
|
|
| T |
38824693 |
cgtgagcttagctcagttgatagggatattgcgtattatatgcaggggtcaaggttcgaaccccg |
38824629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 2023445 - 2023504
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
2023445 |
cgtgagcttagctcaattggtagggatatcacattttatatacaggggtcggggttcgaa |
2023504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 12640657 - 12640594
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | ||||||||||||| |
|
|
| T |
12640657 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaacccc |
12640594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 25833557 - 25833620
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
25833557 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
25833620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 256
Target Start/End: Original strand, 35195837 - 35195927
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||| ||| |||||||||||| ||| ||||| || ||||| ||||||||||||| | |||||||||||||||| ||||| ||||||||||| |
|
|
| T |
35195837 |
gtccccgtaagcatagctcagttggcagggacat-gcattattatatgcaggggccggggttcgaaccccgaacaccccatttattcacctt |
35195927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 36316070 - 36315984
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| ||| ||||| ||||||||||||| | ||||||||||| || | |||||||||||||||||| |
|
|
| T |
36316070 |
cgtgagcatagctcagttggtagg-ataatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcacctta |
36315984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 181 - 235
Target Start/End: Complemental strand, 1563797 - 1563743
Alignment:
| Q |
181 |
gctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
1563797 |
gctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
1563743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 12264064 - 12264118
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||| | | |||||||||| |
|
|
| T |
12264064 |
tagctcagttggtagggatattgcattttatatgcaggggccggagttcgaaccc |
12264118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 237
Target Start/End: Original strand, 13720780 - 13720838
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||| |||| ||||||| |||| ||||||||||||| | |||||||||||||||| |
|
|
| T |
13720780 |
tagctcagttggttgggatattgcatattatatgcaggggccggggttcgaaccccgaa |
13720838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 234
Target Start/End: Complemental strand, 15106758 - 15106696
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||| || ||||| |||||||||||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
15106758 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggagtcggggttcgaacccc |
15106696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 21388527 - 21388589
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
21388527 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
21388589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 24061397 - 24061331
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| ||||||| |||| |||| ||||||||||| | | |||||||||||||||| |
|
|
| T |
24061397 |
cgtgagcttagctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccgaa |
24061331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 28805304 - 28805366
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| | ||||||||||||| ||||| |||||||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatgcaggggtcggggttagaaccccg |
28805366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 235
Target Start/End: Complemental strand, 32677008 - 32676946
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
32677008 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
32676946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 252
Target Start/End: Original strand, 32814826 - 32814907
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattca |
252 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||| ||||||||||||||| | ||||||| |||| | ||||||||||||| |
|
|
| T |
32814826 |
cgtgagcatagctcagttggtagggacat-gcattattatatgcaggggtcggagttcgaatcccggacaccccacttattca |
32814907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 236
Target Start/End: Original strand, 2228977 - 2229042
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccga |
236 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | ||||| |||||||| |
|
|
| T |
2228977 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggtttaaaccccga |
2229042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 4960788 - 4960849
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||||| | |||||||||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
4960788 |
tgagcttagctcagttagtagggatattgcatattatatgcaggagtcggggttcgaacccc |
4960849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 15655708 - 15655769
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| ||||||| |||||||||||| ||||||||||||||||| | ||||||||||||| |
|
|
| T |
15655708 |
tgagcttagctcaattggtagggatattgcattttatatgcagggagcggggttcgaacccc |
15655769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 22548216 - 22548289
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||||||||| ||||| ||| || |||| | ||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
22548216 |
gagcatagctcagttggtaaggacattgcataatttatacaggggtcagggttcgaaccccgaacaccccactt |
22548289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 27424841 - 27424902
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| ||| |||||||| |||| ||||||||||||| | ||||||||||| |
|
|
| T |
27424841 |
cgtgagcttagctcagttggaagggatattgcatattatatgcaggggccggggttcgaacc |
27424902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 27633941 - 27633994
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||| || |||||||||||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
27633941 |
tagcttagttggtagggatattgcatattatatgcaggggtcggggttcgaacc |
27633994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 236
Target Start/End: Original strand, 31112907 - 31112964
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccga |
236 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| | ||||| ||||||||||||||| |
|
|
| T |
31112907 |
tagctcagctggtagggatatcacatattatatataagggtcggggttcgaaccccga |
31112964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 3766813 - 3766877
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
3766813 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
3766877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 9497976 - 9498032
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||||||| |||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
9497976 |
tagctcaattggtagggatattgcatattatatgtaggggtcggggttcgaaccccg |
9498032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 10244957 - 10244893
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| ||| | | |||||||||||||| |
|
|
| T |
10244957 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggagccggggttcgaaccccg |
10244893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 257
Target Start/End: Complemental strand, 10474613 - 10474522
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| |||| |||||| || || |||| ||||||||||||||| |||||||| ||||| | || ||||||||||||||| |
|
|
| T |
10474613 |
gtcctcgtgagcatagttcagttggtagagacata-cattgttatatgcaggggtcggggttcgacccccggacacctcacttattcacctta |
10474522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 21066896 - 21066952
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||| ||||| | |||||||||||||| |
|
|
| T |
21066896 |
tagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccg |
21066952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 26801797 - 26801733
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| ||||||||| ||||||| |||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
26801797 |
cgtgagtatagctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccg |
26801733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 27510325 - 27510261
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||| ||||| |
|
|
| T |
27510325 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgatccccg |
27510261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 257
Target Start/End: Complemental strand, 29658374 - 29658282
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| ||||||||||||||| ||| || || | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
29658374 |
gtccccgtgagcatagctcaattggcagcgacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
29658282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 172 - 232
Target Start/End: Complemental strand, 35835766 - 35835706
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||| |||||||| | |||||||||||| |||||||||||| ||| | ||||||||||| |
|
|
| T |
35835766 |
gtgagcttagctcagttagtagggatatcgtattttatatgcaagggccggggttcgaacc |
35835706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 36389734 - 36389674
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| |||||||| |||||||||||| | |||||||||||||||| | | |||||||| |
|
|
| T |
36389734 |
cgtgagcttagctcagttggtagggatattgtattttatatgcaggggccggagttcgaac |
36389674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 42182266 - 42182206
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| || ||||| |||||||| ||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
42182266 |
cgtgagcttaactcagttggtaggggtattgcatattatatgcaggggtcggggttcgaac |
42182206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 42443691 - 42443755
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | ||||||||| |||| |
|
|
| T |
42443691 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccg |
42443755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 258
Target Start/End: Original strand, 43635622 - 43635674
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcaccttac |
258 |
Q |
| |
|
|||||||||| |||| |||||||||||||| | ||||||||||||||||||| |
|
|
| T |
43635622 |
ttatatgcagcggtcggggttcgaaccccggacaccccacttattcaccttac |
43635674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 173 - 237
Target Start/End: Complemental strand, 46534814 - 46534750
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| ||||||||||| | | | |||||||||||||| |
|
|
| T |
46534814 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagcctgagttcgaaccccgaa |
46534750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 9351068 - 9351119
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| | |||||||||||||| | |||||||||||||||| |
|
|
| T |
9351068 |
ttatatgcaggggtcggagttcgaaccccgaaaactccacttattcacctta |
9351119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 205 - 256
Target Start/End: Original strand, 14707325 - 14707376
Alignment:
| Q |
205 |
tttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
14707325 |
tttatatgcaggggttggggttcgaaccccggacaccccacttattcacctt |
14707376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 29778980 - 29779066
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||| ||||||||||||||| | |||||||| |||||| | ||||||||||||||| |
|
|
| T |
29778980 |
cgtgagcatagctcaattggtagg-ataatgcattattatatgcaggggtcggagttcgaactccgaatacttcacttattcacctta |
29779066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 214 - 257
Target Start/End: Original strand, 30152783 - 30152826
Alignment:
| Q |
214 |
aggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
30152783 |
aggggtcggggttcgaaccccgaacaccccacttattcacctta |
30152826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 31475937 - 31475854
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||||||||||||| ||| ||||| || ||||| ||||||||||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
31475937 |
cgtgagcatagctcagttggcagggacattgcattattatatgcaggggctggggttcgaacccctgacaccccacttattcac |
31475854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 31769568 - 31769517
Alignment:
| Q |
183 |
tcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
31769568 |
tcagttggtagggatattgcatattatatgcaggagtcggggttcgaacccc |
31769517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 32984284 - 32984221
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||| |||||| |||| ||| |||||| ||||||| |
|
|
| T |
32984284 |
gtgagcttagctcagttggtagggatattgcatattatatacaggagtcggggttcaaaccccg |
32984221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 37410577 - 37410491
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||| ||| || ||||| |||||||||||||||| ||||||||| ||| | || ||||||||| ||||| |
|
|
| T |
37410577 |
cgtgagcatagctcagttggtaaggacat-gcattgttatatgcaggggtcaaggttcgaactccggacacctcacttattctcctta |
37410491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 166 - 257
Target Start/End: Original strand, 42352647 - 42352738
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| ||||||| | |||||| ||||||||| || || | |||||||||||| ||||||| |||||||| | |||||||||||| ||||| |
|
|
| T |
42352647 |
gtccccgtgagctttgctcagttggtagggacattgcctaatatatgcaggggccagggtttgaaccccggacgccccacttattctcctta |
42352738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 167 - 249
Target Start/End: Complemental strand, 43712413 - 43712331
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttat |
249 |
Q |
| |
|
||||| |||||||| ||||| ||||||||| || ||||| |||||| |||||||| ||||||||||| || || |||||||||| |
|
|
| T |
43712413 |
tcctcatgagcataactcagttggtagggacat-gcattgttatatacaggggtcggggttcgaacctcggataccccacttat |
43712331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 47641047 - 47641110
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| ||||| ||||||||||||| |
|
|
| T |
47641047 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggctggggttcgaacccc |
47641110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 257
Target Start/End: Original strand, 4169067 - 4169161
Alignment:
| Q |
164 |
gagtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||| | | ||| ||||||||| ||| | ||||| |||||||| | |||||||||||||||||| |
|
|
| T |
4169067 |
gagtccccgtgagcatagctcagttggcagggacaatgtattgttatatgcaagggccggggtttgaaccccggacaccccacttattcacctta |
4169161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 253
Target Start/End: Complemental strand, 15716745 - 15716671
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||||| |||||||||||| || | ||||||||| ||||| |||||||||| || | |||||||||||||| |
|
|
| T |
15716745 |
tagctcagttggtagggatattgcgtattatatgcaagggtcggggttcgaacttcggacaccccacttattcac |
15716671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 234
Target Start/End: Original strand, 16200578 - 16200624
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
16200578 |
tggtaggaatattgcatattatatgcaggggtcggggttcgaacccc |
16200624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 237
Target Start/End: Complemental strand, 24880512 - 24880454
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||| |||||||||||| | || ||||||||||| | | |||||||||||||||| |
|
|
| T |
24880512 |
tagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccgaa |
24880454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 230
Target Start/End: Complemental strand, 35293622 - 35293580
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35293622 |
tggtagagatattgcattttatatgcaagggtcagggttcgaa |
35293580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 166 - 235
Target Start/End: Original strand, 41139080 - 41139150
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
41139080 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaatcccg |
41139150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 235
Target Start/End: Original strand, 8174129 - 8174182
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||| | |||||||||||||| |
|
|
| T |
8174129 |
ctcagttggtagggatattgcattttatatgcaggagctggggttcgaaccccg |
8174182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Complemental strand, 25318587 - 25318538
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||||||| |||||||||||| ||| | | |||||||||||||||| |
|
|
| T |
25318587 |
tggtagggatattgcattttatatgtaggagccggggttcgaaccccgaa |
25318538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 235
Target Start/End: Original strand, 32047110 - 32047155
Alignment:
| Q |
190 |
gtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
32047110 |
gtagggatattgcatgttatatgcaggggccggggttcgaaccccg |
32047155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 216
Target Start/End: Original strand, 44616604 - 44616649
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
44616604 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
44616649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 257
Target Start/End: Original strand, 46716334 - 46716418
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||| ||||||| || ||||| |||||||||| |||| |||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
46716334 |
tgagcatagctcagttggtaggacaat-gcattattatatgcagaggtcggggttcgaaccctgaacaccccacttatttacctta |
46716418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 257
Target Start/End: Original strand, 47552210 - 47552298
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||||| ||||||| || ||||| ||||||||| ||| | |||||||||||||| | ||| |||||||||||||| |
|
|
| T |
47552210 |
ctcgtgagcatagctcagttggtaggacaat-gcattattatatgcaagggccggggttcgaaccccggacaccctacttattcacctta |
47552298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 5804865 - 5804921
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| || |||||||||||| |||||||||||||| ||| | ||||||||||||| |
|
|
| T |
5804865 |
tagcttagttggtagggatattgcattttatatgcaagggccgaggttcgaaccccg |
5804921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 9929964 - 9929908
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| | || |||||||||| |||| | |||||||||||| |
|
|
| T |
9929964 |
tagctcagttggtagggatattgaatattatatgcagcggtcggtgttcgaaccccg |
9929908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 24822878 - 24822818
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| ||||||| || |||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
24822878 |
cgtgagcttagctcaacttgtagggatattatactttatatgcaggggtcggggttcgaac |
24822818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 234
Target Start/End: Original strand, 27788266 - 27788334
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||| |||| | |||||||||| | ||||||||||||| |
|
|
| T |
27788266 |
gtcctcatgagcatagctcaattggcagggatattgcataatttatgcaggggccggggttcgaacccc |
27788334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 234
Target Start/End: Original strand, 27791422 - 27791490
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||| |||| | |||||||||| | ||||||||||||| |
|
|
| T |
27791422 |
gtcctcatgagcatagctcaattggcagggatattgcataatttatgcaggggccggggttcgaacccc |
27791490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 34267619 - 34267555
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||| |||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
34267619 |
cgtgagcttagctcagttggtaggaatattgcatattatatgcaggagctggggttcgaaccccg |
34267555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 173 - 233
Target Start/End: Original strand, 35645603 - 35645663
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||| |||||||| |||||||||||| | || ||||||||||| | | |||||||||||| |
|
|
| T |
35645603 |
tgagcgtagctcagttggtagggatattgtatattatatgcaggagccggggttcgaaccc |
35645663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 36469773 - 36469709
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| ||| ||| ||||||| | | |||||||||||||| |
|
|
| T |
36469773 |
cgtgagcttagctcagttggtagggatattacatattacatgcaggagccggggttcgaaccccg |
36469709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 39829223 - 39829171
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| ||||||| |||| ||||||||||||||||| || | ||||||||||| |
|
|
| T |
39829223 |
ctcagttggtaggaatattgcattttatatgcagggatcggtgttcgaacccc |
39829171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 6e-19; HSPs: 100)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 171 - 247
Target Start/End: Original strand, 7545331 - 7545407
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
7545331 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccccgaacaccccactt |
7545407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 22574872 - 22574936
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22574872 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggttggggttcgaaccccg |
22574936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 166 - 257
Target Start/End: Complemental strand, 20568358 - 20568267
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| ||||||| |||||||| ||||| ||| || |||| |||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
20568358 |
gtccccgtgagcttagctcagttggtaaggacattgcataatatatgcaggggtcggggttcgaaccccgaacaccccacttattcacctta |
20568267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 172 - 235
Target Start/End: Original strand, 31935102 - 31935165
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccg |
31935165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 3294766 - 3294848
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| |||||||||||||| | |||||||| ||||| |
|
|
| T |
3294766 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttcttcac |
3294848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 10483596 - 10483540
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
10483596 |
tagctcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccg |
10483540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 10517201 - 10517265
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||| |||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
10517201 |
cgtgagcttagctcagttggtatggatattgcattttatatgcaggggtcggggttcgaaccccg |
10517265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 24758741 - 24758805
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || |||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24758741 |
cgtgagcttaactcaattggtagggatatcgcattttatatgcaggggtcggggttcgaaccccg |
24758805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 9372269 - 9372207
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
9372269 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccc |
9372207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 172 - 233
Target Start/End: Original strand, 28030867 - 28030928
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
28030867 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccc |
28030928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 5052141 - 5052077
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
5052141 |
cgtgagcttagctcaattggtagggatatcgcattttatatgcaggagtcggggtttgaaccccg |
5052077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 7581046 - 7581106
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| ||||| ||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
7581046 |
cgtgagcttagcttagctggtagggatattgcattttatatgcaggggttggggttcgaac |
7581106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 22389846 - 22389760
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||||||||||||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
22389846 |
cgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggtcagggttcgaatcccggacaccccacttattcacctta |
22389760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 166 - 255
Target Start/End: Original strand, 34524869 - 34524958
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacct |
255 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| || ||||| ||||||||||||| | |||||||| ||||||| |||||||||||||||| |
|
|
| T |
34524869 |
gtccccgtgagcatagctcagttggcagggacat-gcattgttatatgcaggggccggggttcgagccccgaacaccccacttattcacct |
34524958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 173 - 257
Target Start/End: Complemental strand, 25020622 - 25020538
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||||||||| || ||||| ||||||||||||| | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
25020622 |
tgagcatagctcagctggtaggacgat-gcattattatatgcaggggcctgggttcgaaccccggacaccccacttattcacctta |
25020538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 31430725 - 31430672
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||| || |||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
31430725 |
tagctcagttgatagggacattgcattttatatgcaggggtcagggttcgaacc |
31430672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 235
Target Start/End: Original strand, 1435807 - 1435875
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| || ||||| ||||||||||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
1435807 |
tcctcgtgagcttaactcagtaggtagggatattacatattatatgcaggggccagggttcgaaccccg |
1435875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 1968998 - 1969062
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| ||| ||||||||||||| | |||||||||||||| |
|
|
| T |
1968998 |
cgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaaccccg |
1969062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 2251840 - 2251904
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||||| | |||||||||||||| |
|
|
| T |
2251840 |
cgtgagcttagctcagttggtagggatattgcatactatatgcaggggccggggttcgaaccccg |
2251904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 3794241 - 3794177
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
3794241 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccg |
3794177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 7207846 - 7207910
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
7207846 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
7207910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 9246450 - 9246386
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
9246450 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccg |
9246386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 9435628 - 9435692
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
9435628 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccg |
9435692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 10934601 - 10934665
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
10934601 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
10934665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 15091450 - 15091514
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | ||||||||| |||| |
|
|
| T |
15091450 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaatcccg |
15091514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 17441907 - 17441843
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
17441907 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
17441843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 19892344 - 19892280
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||| |||| |||||||||||| |||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
19892344 |
cgtgagcttagttcagttggtagggatattgcatattatatgtaggggtcggggttcgaaccccg |
19892280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 19953896 - 19953832
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
19953896 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
19953832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 22997338 - 22997402
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| | || ||||||| ||||||| |||||||||||||| |
|
|
| T |
22997338 |
cgtgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccg |
22997402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 23791063 - 23790999
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| | || ||||||| ||||||| |||||||||||||| |
|
|
| T |
23791063 |
cgtgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccg |
23790999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 166 - 257
Target Start/End: Original strand, 29169646 - 29169735
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| |||| ||||||||||| ||| ||||| || ||||| |||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29169646 |
gtccccgtgggcatagctcagttggcagggacattgcatt--atatgcagggactggggttcgaaccccggattccccacttattcacctta |
29169735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 237
Target Start/End: Original strand, 34268278 - 34268350
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||| ||||||| |||||| | ||||||||| || |||| | ||||||||||||||||||||||||||||| |
|
|
| T |
34268278 |
agtccccgtgagcttagctccgttggtagggacattgcataatttatgcaggggtcagggttcgaaccccgaa |
34268350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 7177297 - 7177360
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
7177297 |
cgtgagcttagctcagttggtagggatattgtattttatatgcaggggctggggttcgaacccc |
7177360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 7563672 - 7563586
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||| |||||||||||||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
7563672 |
cgtgagcatagctcagttggtaggacaat-gcattattacatgcaggggtcagggttcaaaccccggacaccccacttattcacctta |
7563586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 8439677 - 8439736
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| || |||||| |
|
|
| T |
8439677 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcgggattcgaa |
8439736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 8857092 - 8857155
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| ||| ||||||||||||| | ||||||||||||| |
|
|
| T |
8857092 |
cgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaacccc |
8857155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 10913139 - 10913084
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||||||||| | ||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
10913139 |
tagctcagctggtggagatattgcatattatatgcaggggtcggggttcgaacccc |
10913084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 30668245 - 30668194
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| |||||||||||||||||| |
|
|
| T |
30668245 |
ttatatgcaggggtcagagttcgaaccacgaacaccccacttattcacctta |
30668194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 35190797 - 35190848
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
35190797 |
ttatatgcaggggtcggagttcgaaccccgaacaccccacttattcacctta |
35190848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 235
Target Start/End: Original strand, 743563 - 743629
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||| ||| ||||||| | | |||||||||||||| |
|
|
| T |
743563 |
ctcgtgagcttagctcagttggtagggatattgcatattagatgcaggagccggggttcgaaccccg |
743629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 253
Target Start/End: Original strand, 6143956 - 6144045
Alignment:
| Q |
164 |
gagtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||| | ||||| ||||||| ||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
6143956 |
gagtccccgtgagcatagctcagttggcagggacaatgcattattatatgtaggggtc-gggttcgaaccccggacaccccacttattcac |
6144045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 257
Target Start/End: Complemental strand, 6658647 - 6658553
Alignment:
| Q |
163 |
ggagtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| ||||||| ||||| || | ||||||| || |||| |||||||||||| | |||||||||||||| | |||||||||||| ||||| |
|
|
| T |
6658647 |
ggagtccccgtgagcttagcttagttagtagggaaattgcataatatatgcaggggccggggttcgaaccccggacaccccacttattctcctta |
6658553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 7865423 - 7865361
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | ||||| |||||| |
|
|
| T |
7865423 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggtttgaaccc |
7865361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 19374908 - 19374842
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| | ||||| |||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
19374908 |
cgtgagcttagctcagttagtaggaatattgcatattatatgcaggggttggggttcgaaccccgaa |
19374842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 21248542 - 21248595
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
21248542 |
tagctcagttggtagggatattgcattttatatg-aggggtcagcgttcgaaccc |
21248595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 32050033 - 32049967
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| || |||||||||||||||||| |||| ||||||||||| | | |||||||||| ||||| |
|
|
| T |
32050033 |
cgtgagcttaactcagctggtagggatattgcatattatatgcaggagccggggttcgaactccgaa |
32049967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 235
Target Start/End: Complemental strand, 32611620 - 32611558
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
32611620 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
32611558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 32813718 - 32813636
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||| ||| |||| ||||| |||||| |||| ||||||||||||| | |||||||||||||| || | |||||| ||||| |
|
|
| T |
32813718 |
cgtgagcttagttcagttggtacggatattgcatattatatgcaggggccggggttcgaaccccggatactccacttcttcac |
32813636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 33573819 - 33573881
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||| |
|
|
| T |
33573819 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccc |
33573881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 232
Target Start/End: Original strand, 3640512 - 3640577
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| |||| |||||||| ||| | ||||||||||| |
|
|
| T |
3640512 |
tcctcgtgagcttagctcagttggtagggatattgcatagtatatgcaagggccggggttcgaacc |
3640577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 4408360 - 4408421
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
4408360 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacc |
4408421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 170 - 231
Target Start/End: Original strand, 7414330 - 7414391
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||| | |||||| |||||||||||| |||| ||||||||| ||| |||||||||||| |
|
|
| T |
7414330 |
tcgtgagcttggctcagttggtagggatattgcatattatatgcaagggccagggttcgaac |
7414391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 253
Target Start/End: Complemental strand, 14981805 - 14981716
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||| | | |||||||||||||| |
|
|
| T |
14981805 |
agtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccctggacaccccacttattcac |
14981716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 31705901 - 31705962
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| ||||| |||||| ||||| |||||| ||||||| ||||||||||| |
|
|
| T |
31705901 |
cgtgagcttagctcagttggtatggatattgcattatatatgtaggggtcggggttcgaacc |
31705962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 231
Target Start/End: Complemental strand, 978194 - 978142
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||| | |||||||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
978194 |
tagctcagttagtagggatattgcatattatatgcaggggtcggggttcgaac |
978142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 4869766 - 4869706
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||| ||||||||||||| | |||||||||| |
|
|
| T |
4869766 |
cgtgagcttagctcagttggtagggatactgcatattatatgcaggggccggggttcgaac |
4869706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 227
Target Start/End: Complemental strand, 7328715 - 7328659
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttc |
227 |
Q |
| |
|
||||||| || ||||| |||||||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
7328715 |
cgtgagcttaactcagttggtagggatattgcattttatatccaggggtcggggttc |
7328659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 8297629 - 8297693
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||||| |||||||||| | |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
8297629 |
cgtgagcttagctcaattggtagggatgttgcatgttatatgcaggggccggggttcgaaccccg |
8297693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 17454813 - 17454749
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||| ||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
17454813 |
cgtgagcttatctcagttggtagagatattgcatattatatgcaggagtcggggttcgaaccccg |
17454749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 30704962 - 30705026
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||| |||| |||||||||||| |||| ||||||| ||||| | |||||||||||||| |
|
|
| T |
30704962 |
cgtgagcttagttcagttggtagggatattgcatgttatatgtaggggccggggttcgaaccccg |
30705026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 173 - 256
Target Start/End: Original strand, 30833018 - 30833101
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||| |||| ||| ||||| || ||||| ||||||||||||||| |||||||||||||| | |||||||||||| |||| |
|
|
| T |
30833018 |
tgagcatagttcagttggcagggacat-gcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattctcctt |
30833101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 31802055 - 31802119
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
31802055 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
31802119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 33697181 - 33697117
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| || ||||||||| |||||||||||||||||||| | ||||||| |||| |
|
|
| T |
33697181 |
cgtgagcttaactcagttgatagggatattgcattttatatgcaggggtcggagttcgaatcccg |
33697117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 894683 - 894636
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
894683 |
tggtagggatattgcatattatatgcaggggtcgaggttcgaaccccg |
894636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 1100299 - 1100244
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||| ||| | ||||||||||| |
|
|
| T |
1100299 |
tagctcagttggtagggatatagcattttatatgcagtagtcggtgttcgaacccc |
1100244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 4661098 - 4661161
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| ||||| || |||||||||||| |||| |||||||||||||| || |||||||||| |
|
|
| T |
4661098 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggggttgggtttcgaacccc |
4661161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 5544310 - 5544361
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||||||||||||| || |||||||||||| ||||| |
|
|
| T |
5544310 |
ttatatgcaggggtcggggttcgaaccccagataccccacttattctcctta |
5544361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 6210064 - 6210119
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
6210064 |
tagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
6210119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 12089096 - 12089182
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||||||||||||| | | |||||||||||| | |||||||||||||||||| |
|
|
| T |
12089096 |
cgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggccggagttcgaaccccggacaccccacttattcacctta |
12089182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 18631506 - 18631553
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||||| || |||||||||| ||| |||||||||||||| |
|
|
| T |
18631506 |
ttatatgcaggggtcgggattcgaaccccaaataccccacttattcac |
18631553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 30885638 - 30885575
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||| |||||| ||||||||||||| |
|
|
| T |
30885638 |
cgtgagcttagctcagttggtagggatattgcatattatatacaggggctggggttcgaacccc |
30885575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 34432865 - 34432802
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| ||| |||| |||||||||||| |||| |||||||||| ||| ||||||||||||| |
|
|
| T |
34432865 |
cgtgagcttagttcagttggtagggatattgcatattatatgcagaggttggggttcgaacccc |
34432802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 492904 - 492966
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| ||| | |||||| |||| ||||||||||||| | |||||||||||| |
|
|
| T |
492904 |
cgtgagcttagctcagttggcaaggatattgcatattatatgcaggggccggggttcgaaccc |
492966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 220
Target Start/End: Complemental strand, 10501200 - 10501158
Alignment:
| Q |
178 |
atagctcagctggtagggatatcgcattttatatgcaggggtc |
220 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||||||||||||| |
|
|
| T |
10501200 |
atagctcagttggtagggatattgcatattatatgcaggggtc |
10501158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 201 - 235
Target Start/End: Original strand, 18904297 - 18904331
Alignment:
| Q |
201 |
gcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
18904297 |
gcattttatatgcaggggtcggggttcgaaccccg |
18904331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 257
Target Start/End: Complemental strand, 21030863 - 21030786
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg--aattccccacttattcacctta |
257 |
Q |
| |
|
||||| |||||| || |||||||||||||| || ||| | |||||||||||||| || |||||||||||| |||||| |
|
|
| T |
21030863 |
ctcagttggtagagacatcgcattttatatacaagggccggggttcgaaccccgaaaactccccacttatttacctta |
21030786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 256
Target Start/End: Original strand, 24256950 - 24257000
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||| | ||||||||||||| || ||||||||||||||||| |
|
|
| T |
24256950 |
ttatatgcaggggccgaggttcgaaccccggataccccacttattcacctt |
24257000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 250
Target Start/End: Original strand, 2945589 - 2945674
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttatt |
250 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||||| |||||| |||| || | ||||||||||| |
|
|
| T |
2945589 |
gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcaaacctcggacaccccacttatt |
2945674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 3795834 - 3795781
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
3795834 |
tagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacc |
3795781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 235
Target Start/End: Original strand, 7072091 - 7072144
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||||||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
7072091 |
ctcagttggtagggatattacatattatatgcaggagtcggggttcgaaccccg |
7072144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 231
Target Start/End: Original strand, 7425399 - 7425440
Alignment:
| Q |
190 |
gtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
7425399 |
gtagggatattccatattatatgcaggggtcagggttcgaac |
7425440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 250
Target Start/End: Original strand, 9064859 - 9064944
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttatt |
250 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | ||||||||||||| | ||||||||||| |
|
|
| T |
9064859 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatt |
9064944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 236
Target Start/End: Original strand, 9704427 - 9704484
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccga |
236 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
9704427 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccga |
9704484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 257
Target Start/End: Complemental strand, 12128007 - 12127919
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||||| ||||||| || ||||| ||||||||||||||| | ||||||||||| | | |||||||||||||||| |
|
|
| T |
12128007 |
ctcgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggtcggaattcgaaccccggacacgccacttattcacctta |
12127919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 235
Target Start/End: Complemental strand, 13116689 - 13116628
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| |||||||| ||||| ||||||| ||| ||||||||| ||| | |||||||||||||| |
|
|
| T |
13116689 |
gagcttagctcagttggtaaggatatcacatattatatgcaagggccggggttcgaaccccg |
13116628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 235
Target Start/End: Complemental strand, 16268179 - 16268138
Alignment:
| Q |
194 |
ggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
16268179 |
ggatattgcattttatatgcaggggccggggttcgaaccccg |
16268138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 257
Target Start/End: Complemental strand, 16269815 - 16269727
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| | ||||||| | | ||||| |||||||||||||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
16269815 |
ctcgtgagcatagctcggttggtagg-acagtgcattattatatgcaggggttgaggatcgaaccccgaacgccccacttattcacctta |
16269727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 247
Target Start/End: Complemental strand, 16719368 - 16719312
Alignment:
| Q |
190 |
gtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
|||||||||| |||| ||||||||||||| || |||||||||||||||| | |||||| |
|
|
| T |
16719368 |
gtagggatattgcatattatatgcagggg-caaggttcgaaccccgaatactccactt |
16719312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 235
Target Start/End: Complemental strand, 16913945 - 16913904
Alignment:
| Q |
194 |
ggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
16913945 |
ggatattgcatattatatgcaggggtcggggttcgaaccccg |
16913904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 256
Target Start/End: Complemental strand, 26669762 - 26669670
Alignment:
| Q |
164 |
gagtcctcgtgagcatagctcagctggtagggatatcgcat-tttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||| || |||| ||||||| ||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
26669762 |
gagtccccgtgagcatagctcagttggtagggacat-gcataattatatgtaggggctggggttcgaaccccagacaccccacttattcacctt |
26669670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 28237324 - 28237275
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||||||| || ||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
28237324 |
tcctcgtgagcttaactcagttggtagggatattgcatattatatgcagg |
28237275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 33646853 - 33646898
Alignment:
| Q |
188 |
tggtagggatatcgcat-tttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| ||||||||||| |
|
|
| T |
33646853 |
tggtagggatattgcatatttatatgcaggggtcggggttcgaacc |
33646898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 257
Target Start/End: Original strand, 3448345 - 3448437
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||| | ||||| ||||| ||||||| | |||||||||||||| | ||||||||||||| |||| |
|
|
| T |
3448345 |
gtccccgtgagcatagctcaattggcagggacaatgcattgttatacgcaggggccggggttcgaaccccggacaccccacttattcatctta |
3448437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 12284123 - 12284183
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| || ||||| |||||||||||| | || ||||||||||| ||| |||||||||| |
|
|
| T |
12284123 |
cgtgagcttaactcagttggtagggatattgaatattatatgcaggtgtcggggttcgaac |
12284183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 173 - 233
Target Start/End: Complemental strand, 15964009 - 15963949
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| || |||||||||| |||||||||||| |
|
|
| T |
15964009 |
tgagcttagctcagttggtagggatattgcatattttatgcaggggctggggttcgaaccc |
15963949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 219
Target Start/End: Complemental strand, 27094875 - 27094827
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggt |
219 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
27094875 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggt |
27094827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 164 - 235
Target Start/End: Original strand, 27667154 - 27667226
Alignment:
| Q |
164 |
gagtcctcgtgagcatagctcagctggtagggatatc-gcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| ||||||| | |||||| ||||||||| | |||||||||||||||||| | |||||||||||||| |
|
|
| T |
27667154 |
gagtccccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccg |
27667226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 28148793 - 28148737
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | || ||||||||||| |
|
|
| T |
28148793 |
tagctcagttggtagggatattgcatattatatgcaggagccgggtttcgaaccccg |
28148737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 29284276 - 29284332
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||| ||||| | | |||||||||||| |
|
|
| T |
29284276 |
tagctcagttggtagggatattgcatattatatgaaggggccggagttcgaaccccg |
29284332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 32166371 - 32166435
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| ||||||||||||| | || || |||||||| |
|
|
| T |
32166371 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggggccgggatttgaaccccg |
32166435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 6e-19; HSPs: 151)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 37488528 - 37488464
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
37488528 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccggggttcgaaccccg |
37488464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 167 - 233
Target Start/End: Complemental strand, 30779639 - 30779573
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
30779639 |
tcctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccc |
30779573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 49408777 - 49408838
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
49408777 |
cgtgagcttagctcagctggtagggatatcgcatattatatgcaggagtcggggttcgaacc |
49408838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 173 - 253
Target Start/End: Original strand, 45118644 - 45118724
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||| |||||||| ||||||||| || ||||| |||||||||||| | |||||||||||| | ||||||||||||||||| |
|
|
| T |
45118644 |
tgagcttagctcagttggtagggacattgcattatatatgcaggggccggggttcgaacccgggattccccacttattcac |
45118724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 235
Target Start/End: Original strand, 50659588 - 50659656
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| || ||||| ||||||||||||| ||||||||||||||||| | |||||||||||||| |
|
|
| T |
50659588 |
tcctcgtgagcttaactcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccg |
50659656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 33225416 - 33225353
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||| | | ||||||||||||| |
|
|
| T |
33225416 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccggggttcgaacccc |
33225353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 206 - 256
Target Start/End: Original strand, 28951900 - 28951950
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28951900 |
ttatatgcaggggtcagggttcgaaccccgaacaccccacttattcacctt |
28951950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 46795997 - 46795935
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
46795997 |
cgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaaccc |
46795935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 52945897 - 52945959
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
52945897 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccc |
52945959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 14868678 - 14868766
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
14868678 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcac |
14868766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 32256622 - 32256558
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
32256622 |
cgtgagcttagctcagttggtagggatattgcatgttatatgcaggggccggggttcgaaccccg |
32256558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 45551877 - 45551813
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||| ||||| | || ||||||||||| |
|
|
| T |
45551877 |
cgtgagcttagctcagttggtagggatatcgcattttatatgtaggggccgggattcgaaccccg |
45551813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 51467186 - 51467242
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51467186 |
tagctcagttgatagggatatcgcattttatatgcaggggttggggttcgaaccccg |
51467242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 27066644 - 27066695
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
27066644 |
ttatatgcaggggtcagggttcgaaccccggacaccccacttattcacctta |
27066695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 32508855 - 32508804
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
32508855 |
ttatatgcaggggtcggggttcgaaccccgaacaccccacttattcacctta |
32508804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 32732588 - 32732545
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32732588 |
tggtagggatatcgcattttatatgcaggggtcggggttcgaac |
32732545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 42920707 - 42920652
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42920707 |
tagctcagttggtaggaatatcgcattttatatgcaggggttggggttcgaacccc |
42920652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 47098734 - 47098797
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | ||||||||||||| |
|
|
| T |
47098734 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacccc |
47098797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 48739812 - 48739749
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
48739812 |
cgtgagcttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaacccc |
48739749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 6920031 - 6919965
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||||| |
|
|
| T |
6920031 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccgaa |
6919965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 183 - 253
Target Start/End: Original strand, 19879215 - 19879285
Alignment:
| Q |
183 |
tcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| | |||||||||||||||| |||||||| ||||| |
|
|
| T |
19879215 |
tcagctggtagggatactacattttatatgcaggggccggggttcgaaccccgaacaccccacttcttcac |
19879285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 28193802 - 28193864
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| || ||||| |||||||||||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
28193802 |
tgagcttaactcagttggtagggatattgcattttatatgcaggggtcggggtacgaaccccg |
28193864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 164 - 257
Target Start/End: Original strand, 47191364 - 47191458
Alignment:
| Q |
164 |
gagtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
47191364 |
gagtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggagttcgaaccccgaacaccccacttattcacctta |
47191458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 50727312 - 50727246
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| || ||||| ||||||||||||||||||||||||| ||||| | || ||||||||||||| |
|
|
| T |
50727312 |
cgtgagcctaactcagttggtagggatatcgcattttatatgaaggggccgggattcgaaccccgaa |
50727246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 50785536 - 50785602
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| || ||||| ||||||||||||||||||||||||| ||||| | || ||||||||||||| |
|
|
| T |
50785536 |
cgtgagcctaactcagttggtagggatatcgcattttatatgaaggggccgggattcgaaccccgaa |
50785602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 51425842 - 51425904
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| || ||||| ||||||||||||| ||||||||||||||||| | |||||||||||| |
|
|
| T |
51425842 |
cgtgagcttaactcagttggtagggatatcacattttatatgcaggggccggggttcgaaccc |
51425904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 170 - 231
Target Start/End: Original strand, 8756525 - 8756586
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||| || ||||| ||||||| |||| |||||||||||||||||||| |||||||||| |
|
|
| T |
8756525 |
tcgtgagcttaactcagttggtaggaatattgcattttatatgcaggggtcggggttcgaac |
8756586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 26942763 - 26942816
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
26942763 |
tagctcagttggtagggatattgcatattatatgcaggggccagggttcgaacc |
26942816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 252
Target Start/End: Original strand, 32421339 - 32421428
Alignment:
| Q |
164 |
gagtcctcgtgagcatagctcagctggta-gggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattca |
252 |
Q |
| |
|
|||||| | ||||| ||||||| |||||| |||||| |||| |||||||||||||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
32421339 |
gagtccccatgagcttagctcatctggtaagggataatgcataatatatgcaggggtcggggttcgaacctcgaactccccacttattca |
32421428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 3748670 - 3748606
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| | || |||||||||||||| |||||||||||||| |
|
|
| T |
3748670 |
cgtgagcttagctcagttggtagggatattgtatattatatgcaggggttggggttcgaaccccg |
3748606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 4139002 - 4139066
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
4139002 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
4139066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 4200642 - 4200590
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
4200642 |
ctcagttggtagggatattgcatattatatgcaggggtcggggttcgaacccc |
4200590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 9220312 - 9220256
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
9220312 |
tagctcaattggtagggatatcgtattttatatgcaggagtcggggttcgaaccccg |
9220256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 9624976 - 9625064
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
9624976 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
9625064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 11820006 - 11820070
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| ||| ||| |||||||||||||| |
|
|
| T |
11820006 |
cgtgagcttagctcagttggtagggatattgcatgttatatgtaggagtcggggttcgaaccccg |
11820070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 17602748 - 17602680
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| |||| ||||||| ||||| | ||||||||||||| |
|
|
| T |
17602748 |
tcctcgtgagcttagctcagttggtagggatattgcatattatatgtaggggccgaggttcgaaccccg |
17602680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 19996520 - 19996456
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| || |||||||||||||| |
|
|
| T |
19996520 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagttggggttcgaaccccg |
19996456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 24559382 - 24559470
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| | | ||||||| |||| ||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
24559382 |
gtccccgtgagcatagctcagttagcagggataatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
24559470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 166 - 253
Target Start/End: Complemental strand, 27183783 - 27183695
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
27183783 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
27183695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 28689732 - 28689676
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
28689732 |
tagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
28689676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 31327569 - 31327505
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
31327569 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
31327505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 31327786 - 31327722
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
31327786 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
31327722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 31529026 - 31528962
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| | || ||||||||||| ||| |||||||||||||| |
|
|
| T |
31529026 |
cgtgagcttagctcagttggtagggatattgaatattatatgcaggagtcggggttcgaaccccg |
31528962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 33606999 - 33606944
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
33606999 |
tagctcaattggtagggatattgcattttatatgcaggggtc-gggttcgaaccccg |
33606944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 34102679 - 34102615
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||| |||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
34102679 |
cgtgagcttagttcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
34102615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 37800679 - 37800615
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
37800679 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
37800615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 39719945 - 39720001
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
39719945 |
tagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
39720001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 40548305 - 40548369
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
40548305 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
40548369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 40933899 - 40933835
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
40933899 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
40933835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 40963779 - 40963715
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| || || |||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
40963779 |
cgtgagcttaactcagttgataaggatattgcattttatatgcaggggtcggggttcgaaccccg |
40963715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 41936467 - 41936411
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
41936467 |
tagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
41936411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 166 - 257
Target Start/End: Original strand, 43774178 - 43774270
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||| |||||| ||||||||| ||| ||||| | ||||| ||||||||||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
43774178 |
gtccccgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcgaaccccagacaccccacttattcacctta |
43774270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 247
Target Start/End: Complemental strand, 44652050 - 44651974
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | ||||||||||||| || |||||||| |
|
|
| T |
44652050 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggataccccactt |
44651974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 45701346 - 45701410
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
45701346 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
45701410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 45871027 - 45871083
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| | || ||||||||||||||| |||||||||||||| |
|
|
| T |
45871027 |
tagctcagttggtagggatattgtatattatatgcaggggtcggggttcgaaccccg |
45871083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 49447140 - 49447204
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| ||||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
49447140 |
cgtgagtatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
49447204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 50496882 - 50496818
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
50496882 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
50496818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 53163596 - 53163660
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| ||||| | |||||||||||||| |
|
|
| T |
53163596 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccg |
53163660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 2368934 - 2369001
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||||||| |||||||| || ||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
2368934 |
tcctcgtgagcttagctcagttgttagggatattgcatattatatgcaggggctggggttcgaacccc |
2369001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 19999869 - 19999932
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
19999869 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
19999932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 22501999 - 22501936
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
22501999 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
22501936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 36331823 - 36331740
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||||| ||| ||||| | ||||| ||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
36331823 |
cgtgagcatagctcaattggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
36331740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 209 - 256
Target Start/End: Original strand, 45431664 - 45431711
Alignment:
| Q |
209 |
tatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
45431664 |
tatgcaggggtcagggttcgaaccccggacaccccacttattcacctt |
45431711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 172 - 235
Target Start/End: Original strand, 52984013 - 52984076
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||| || |||||| ||||| |||||||||||||| |
|
|
| T |
52984013 |
gtgagcttagctcagttggtagggatattgcatattgtatgcaagggtcggggttcgaaccccg |
52984076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 188 - 235
Target Start/End: Original strand, 54626362 - 54626409
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
54626362 |
tggtagggatatcgcattttatatgtaggagtcggggttcgaaccccg |
54626409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 233
Target Start/End: Complemental strand, 5636871 - 5636805
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||| |||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||| |
|
|
| T |
5636871 |
tccttgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccc |
5636805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 234
Target Start/End: Complemental strand, 7938363 - 7938301
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||| || ||||| |||||||||||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
7938363 |
gtgagcttaactcagttggtagggatattacattttatatgtaggggtcggggttcgaacccc |
7938301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 172 - 234
Target Start/End: Original strand, 27983858 - 27983920
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||| |||||||| |||||| |||| |||||||||||||||||||| ||||| ||||||| |
|
|
| T |
27983858 |
gtgagcttagctcagttggtagaaatattgcattttatatgcaggggtcggggtttgaacccc |
27983920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 31586951 - 31587013
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| ||||||||||||||| | ||||||| |||| |
|
|
| T |
31586951 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggagttcgaatcccg |
31587013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 247
Target Start/End: Original strand, 34740287 - 34740365
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
|||||||| |||| ||| |||||||||||| |||| ||||||||| ||| |||||||||||||| ||| || |||||| |
|
|
| T |
34740287 |
ctcgtgagtttagcccagttggtagggatattgcatattatatgcatgggccagggttcgaaccctgaactctccactt |
34740365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 46879999 - 46880065
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| || ||||||||| ||||||||||||||| || | ||||||||||||||| |
|
|
| T |
46879999 |
cgtgagcttagctcagttgatagggatattgcattttatatgcagaggccgaggttcgaaccccgaa |
46880065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 256
Target Start/End: Original strand, 49639027 - 49639112
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||||||| ||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
49639027 |
cgtgagcatagctcagttggtaggacaat-gcattattatatgtaggggccggggttcgaaccccgaacaccccacttattcacctt |
49639112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 52046453 - 52046391
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| ||||||||||| || |||| |||||||||||| |
|
|
| T |
52046453 |
cgtgagcttagctcagttggtagggatattgcattttatatacaatggtcggggttcgaaccc |
52046391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 6488128 - 6488189
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| ||||||| |||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
6488128 |
tgagcttagctcaattggtagggatattgcatattatatgcaggggctagggttcgaacccc |
6488189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 188 - 237
Target Start/End: Complemental strand, 14644881 - 14644832
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | ||||||||||||| |
|
|
| T |
14644881 |
tggtagggatattgcattttatatgcaggggtcggaattcgaaccccgaa |
14644832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 39966142 - 39966081
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
39966142 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggttgaggttcgaacc |
39966081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 182 - 235
Target Start/End: Complemental strand, 53432794 - 53432741
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
53432794 |
ctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
53432741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 7920322 - 7920386
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||| | | | |||||||||||||| |
|
|
| T |
7920322 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccg |
7920386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 9176654 - 9176590
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||| | | | |||||||||||||| |
|
|
| T |
9176654 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccg |
9176590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 10176963 - 10176907
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
10176963 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
10176907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 172 - 232
Target Start/End: Original strand, 15975155 - 15975215
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||| ||||||||||| | | ||||||||||| |
|
|
| T |
15975155 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaacc |
15975215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 18194348 - 18194404
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
18194348 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
18194404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 173 - 237
Target Start/End: Complemental strand, 28396848 - 28396784
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||| || ||||| |||||||||||| |||| ||||||||||||||| ||||||| | |||||| |
|
|
| T |
28396848 |
tgagcttaactcagttggtagggatattgcatgttatatgcaggggtcggggttcgtatcccgaa |
28396784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 34847557 - 34847605
Alignment:
| Q |
183 |
tcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
34847557 |
tcagttggtagggatattgcatattatatgcaggggtcggggttcgaac |
34847605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 173 - 237
Target Start/End: Complemental strand, 36625237 - 36625173
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| ||||||||||| || |||||||||| ||||| |
|
|
| T |
36625237 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagttggggttcgaactccgaa |
36625173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 256
Target Start/End: Original strand, 38414903 - 38414967
Alignment:
| Q |
192 |
agggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| |||| | ||| ||||||||||||||||| |
|
|
| T |
38414903 |
agggataatgcatattatatgcaggggtcagggtttgaactctgaacaccccacttattcacctt |
38414967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 40192158 - 40192222
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||| |||| | ||||||| |||| |
|
|
| T |
40192158 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagaggtcggtgttcgaatcccg |
40192222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 48546175 - 48546239
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||| ||||| |||| ||||||| |||| || |||||||||||||| |
|
|
| T |
48546175 |
cgtgagcttagctcagttggtagtgatattgcatattatatgtagggatcggggttcgaaccccg |
48546239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 50234126 - 50234190
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
50234126 |
cgtgagcttacctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
50234190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 51772908 - 51772952
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
51772908 |
tggtagggatattgcatattatatgcaggggtcggggttcgaacc |
51772952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 52974121 - 52974057
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
52974121 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
52974057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 362977 - 363024
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||||| | |||||||||||| || |||||||||||||| |
|
|
| T |
362977 |
ttatatgcaggggtcggagttcgaaccccggataccccacttattcac |
363024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 1697916 - 1697853
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcat-tttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| || ||||| | |||||||||| |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
1697916 |
cgtgagcttaactcagttagtagggatattgcatatttatatgcaggggtcagggttcaaaccc |
1697853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 1743865 - 1743802
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| || |||| |||||||||||| |||||||||||| ||||| | ||||||||||||| |
|
|
| T |
1743865 |
cgtgagcttaactcaattggtagggatattgcattttatatgtaggggccggggttcgaacccc |
1743802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 218
Target Start/End: Original strand, 4860163 - 4860210
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
||||||| |||||||| ||||| |||||| |||||||||||||||||| |
|
|
| T |
4860163 |
cgtgagcttagctcagttggtacggatattgcattttatatgcagggg |
4860210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 7448460 - 7448377
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||||||||||||| || |||||| | ||||| ||||||||||||| | || |||||||||| || |||||||||||||| |
|
|
| T |
7448460 |
cgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttattcac |
7448377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 7456602 - 7456519
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||||||||||||| || |||||| | ||||| ||||||||||||| | || |||||||||| || |||||||||||||| |
|
|
| T |
7456602 |
cgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttattcac |
7456519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 8125641 - 8125700
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||||| | ||||||||| |
|
|
| T |
8125641 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggaccggggttcgaa |
8125700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 166 - 284
Target Start/End: Original strand, 10959126 - 10959245
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcaccttacggttgg |
264 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| |||||| ||||| | |||||||||||||| | |||||||||||||| ||| || |
|
|
| T |
10959126 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatataggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
10959225 |
T |
 |
| Q |
265 |
acttctagtcactagactac |
284 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
10959226 |
atttctagtcactagactac |
10959245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 24537861 - 24537912
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||| | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
24537861 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
24537912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 25938990 - 25938935
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
25938990 |
tagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
25938935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 218
Target Start/End: Complemental strand, 28550387 - 28550340
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
28550387 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggg |
28550340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 33206756 - 33206842
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| ||||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
33206756 |
cgtgagcatagctcagttggtaggacaat-gcattattatatgcaggggctggggttcgaaccccggacaccccacttattcacctta |
33206842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 35483303 - 35483354
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||||||||| |||| | |||||||||||||||||| |
|
|
| T |
35483303 |
ttatatgcaggggtcggggttcgaatcccggacaccccacttattcacctta |
35483354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 227
Target Start/End: Complemental strand, 36834772 - 36834717
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttc |
227 |
Q |
| |
|
|||||| ||||||||||| ||||||||| | || ||||||||||||||| |||||| |
|
|
| T |
36834772 |
gtgagcttagctcagctgatagggatattgtatattatatgcaggggtcggggttc |
36834717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 213 - 280
Target Start/End: Original strand, 43922250 - 43922317
Alignment:
| Q |
213 |
caggggtcagggttcgaaccccgaattccccacttattcaccttacggttggacttctagtcactaga |
280 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||| || ||| || || | |||||| ||||||| |
|
|
| T |
43922250 |
caggggtcagggttcgaaccccggattctccacttatttacattaggggtgaatttctagccactaga |
43922317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 46328985 - 46328934
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||| | |||||||||||||| | |||||||||||||||||| |
|
|
| T |
46328985 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
46328934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 235
Target Start/End: Original strand, 48722267 - 48722310
Alignment:
| Q |
192 |
agggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
48722267 |
agggatattgcatattatatgcaggggtcggggttcgaaccccg |
48722310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 49146118 - 49146165
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
49146118 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
49146165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 49194743 - 49194696
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||| |||| ||||||| |||||||||||||||||||||| |
|
|
| T |
49194743 |
tggtaggaatattgcatattatatgtaggggtcagggttcgaaccccg |
49194696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 52309178 - 52309115
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| |||||||||| ||| ||||||||||||| |
|
|
| T |
52309178 |
cgtgagcttaactcagttggtagggatattgcatactatatgcaggagtcggggttcgaacccc |
52309115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 52410309 - 52410246
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | || |||||||||| |
|
|
| T |
52410309 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggattcgaacccc |
52410246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 53347358 - 53347295
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
53347358 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggactggggttcgaacccc |
53347295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 882391 - 882453
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | |||||||||||| |
|
|
| T |
882391 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccc |
882453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 232
Target Start/End: Complemental strand, 11250660 - 11250598
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||| | |||||||| |||||||||||| |||| |||||||||||| | ||||||||||| |
|
|
| T |
11250660 |
tcgtgaacttagctcagttggtagggatattgcatattatatgcagggtccggggttcgaacc |
11250598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 233
Target Start/End: Original strand, 11436502 - 11436568
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||||| | || ||||| |||||||||||| |||| ||||||||||||| | ||||||||||| |
|
|
| T |
11436502 |
tcctcgtgaacttaactcagttggtagggatattgcatattatatgcaggggccgtggttcgaaccc |
11436568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 201 - 235
Target Start/End: Complemental strand, 15085722 - 15085688
Alignment:
| Q |
201 |
gcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
15085722 |
gcattttatatgcaggggtcggggttcgaaccccg |
15085688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 17218492 - 17218554
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||||||| |||| ||||||||| ||| | |||||| ||||||| |
|
|
| T |
17218492 |
tgagcttagctcagttggtagggatattgcatattatatgcaagggccggggttcaaaccccg |
17218554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 17608387 - 17608325
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| || || || |||||||||||| |||| ||||||||||||| | |||||||||||| |
|
|
| T |
17608387 |
cgtgagcttaacttagttggtagggatattgcatattatatgcaggggccggggttcgaaccc |
17608325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 20489819 - 20489881
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||| ||| |||| ||||||||||||| | | |||||||||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatgcaggggccggagttcgaaccccg |
20489881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 256
Target Start/End: Complemental strand, 21249051 - 21249001
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||| | |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
21249051 |
ttatatgcaggggccggggttcgaaccctgaacaccccacttattcacctt |
21249001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 221
Target Start/End: Original strand, 26259139 - 26259181
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtca |
221 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
26259139 |
tagctcaattggtagggatatcgcatattatatgcaggggtca |
26259181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 235
Target Start/End: Original strand, 27668922 - 27668988
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||| ||| ||| |||||||| |||| ||||||||||||| | ||| |||||||||||||| |
|
|
| T |
27668922 |
ctcgtgagcttagttcaattggtaggggtatcacattttatatgcaagagtcggggttcgaaccccg |
27668988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 256
Target Start/End: Original strand, 32080089 - 32080139
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||| | ||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
32080089 |
ttatatgtatgggtcggggttcgaaccccgaacaccccacttattcacctt |
32080139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 229
Target Start/End: Complemental strand, 50536900 - 50536842
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcga |
229 |
Q |
| |
|
||||||| |||||||| |||||| ||||| |||| ||||||||||| ||| |||||||| |
|
|
| T |
50536900 |
cgtgagcttagctcagttggtagagatattgcatattatatgcaggtgtcggggttcga |
50536842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 256
Target Start/End: Complemental strand, 50676928 - 50676878
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||| |||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
50676928 |
ttatatgtaggggttggggttcgaaccccgaacaccccacttattcacctt |
50676878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 166 - 251
Target Start/End: Complemental strand, 51412091 - 51412006
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattc |
251 |
Q |
| |
|
|||||||| ||||||| |||| ||| ||||| || ||||| ||||||||||| ||| ||||||||| |||| || |||||||||||| |
|
|
| T |
51412091 |
gtcctcgtaagcatagttcagttggcagggacat-gcattgttatatgcaggagtcggggttcgaatcccggataccccacttattc |
51412006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 207 - 257
Target Start/End: Complemental strand, 54983765 - 54983715
Alignment:
| Q |
207 |
tatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||||| |||||||||||| |
|
|
| T |
54983765 |
tatatgcaggggtcggggttcgaaccccggacaccccatttattcacctta |
54983715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 256
Target Start/End: Complemental strand, 4010113 - 4010029
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||| ||||||||||||| | ||| |||||||||| ||||| ||||||||||| |
|
|
| T |
4010113 |
gtgagcatagctcagttggtagggacat-gcattgttatatgcaggggccgcagtttgaaccccgaacaccccatttattcacctt |
4010029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 216
Target Start/End: Original strand, 7269957 - 7270002
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
7269957 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7270002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 216
Target Start/End: Original strand, 19550508 - 19550553
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
19550508 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19550553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 235
Target Start/End: Original strand, 29098705 - 29098758
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||| ||||| | || ||||||||||||||| |||||||||||||| |
|
|
| T |
29098705 |
ctcagttggtagagatattgtatattatatgcaggggtcggggttcgaaccccg |
29098758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 29373517 - 29373456
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
||||||| || ||||| ||||| |||||| |||| ||||||||||||| | ||||||||||| |
|
|
| T |
29373517 |
cgtgagcttaactcagttggtaaggatattgcatattatatgcaggggccggggttcgaacc |
29373456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 257
Target Start/End: Complemental strand, 31902268 - 31902215
Alignment:
| Q |
204 |
ttttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||| ||||||| |||||||||| ||| | |||||||||||||||||| |
|
|
| T |
31902268 |
ttttatatgtaggggtcggggttcgaactccggacaccccacttattcacctta |
31902215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 208 - 257
Target Start/End: Complemental strand, 41460409 - 41460360
Alignment:
| Q |
208 |
atatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| |||||| |||||||| |||| || |||||||||||||||||| |
|
|
| T |
41460409 |
atatgcaagggtcatggttcgaatcccggataccccacttattcacctta |
41460360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 235
Target Start/End: Original strand, 44364034 - 44364087
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||| |||| | |||||||||||| |
|
|
| T |
44364034 |
ctcagttggtagggatattgcatattatatgcagaggtctgagttcgaaccccg |
44364087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 247
Target Start/End: Complemental strand, 46336571 - 46336494
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcg-cattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||| |||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
46336571 |
cgtgagcttagctcagttggtagggataaatacataatatatgcaggggtcggggttcgaaccccgaacaccccactt |
46336494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 2390414 - 2390358
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| || ||||||||| |||| ||||||||||| | ||||||||||||||| |
|
|
| T |
2390414 |
tagctcagttgatagggatattgcatattatatgcaggagctagggttcgaaccccg |
2390358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 235
Target Start/End: Original strand, 3784069 - 3784133
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||||||| ||| ||||| | ||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
3784069 |
gtgagcatagctcagttggcagggacaatgcattattatatacaggggtcggggttcgaaccccg |
3784133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 4880171 - 4880215
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcag |
215 |
Q |
| |
|
||||||| |||||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
4880171 |
cgtgagcttagctcagttggtacggatattgcattttatatgcag |
4880215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 235
Target Start/End: Original strand, 6447052 - 6447096
Alignment:
| Q |
191 |
tagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||| | || ||| |||||||||||||||||||||||||| |
|
|
| T |
6447052 |
tagggatattgtatattacatgcaggggtcagggttcgaaccccg |
6447096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 12894598 - 12894538
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||||||||||| || || | |||||||||| |
|
|
| T |
12894598 |
cgtgagcttaactcagttggtagggatattgcattttatatgtagaggccggggttcgaac |
12894538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 32144586 - 32144650
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||| || |||||||| ||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
32144586 |
cgtgagcttagcttagttggtaggggtattgcatattatatgcaggagccggggttcgaaccccg |
32144650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 36842156 - 36842243
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatttt-atatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||| |||||||| ||||| || ||||||||| ||||||| | || |||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
36842156 |
gtcctcatgagcataactcagttgatagggatat-gcatttttaaattcaggggtcggggttcgaaccccgtacatcccacttattcac |
36842243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 37112814 - 37112858
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggg |
217 |
Q |
| |
|
||||| |||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
37112814 |
tgagcttagctcagttggtaaggatattgcattttatatgcaggg |
37112858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 247
Target Start/End: Complemental strand, 38745361 - 38745325
Alignment:
| Q |
211 |
tgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| |
|
|
| T |
38745361 |
tgcaggggtcgggattcgaaccccgaattccccactt |
38745325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 247
Target Start/End: Original strand, 38949684 - 38949752
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
|||||||| ||||||||| || |||| | |||||||||| | |||||||||||||||| |||||||| |
|
|
| T |
38949684 |
tagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccgaacaccccactt |
38949752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 237
Target Start/End: Complemental strand, 41253787 - 41253751
Alignment:
| Q |
201 |
gcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| |
|
|
| T |
41253787 |
gcattttatatgcaggggccggggttcgaaccccgaa |
41253751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 42108242 - 42108186
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||| || | || ||||||||||| |
|
|
| T |
42108242 |
tagctcagttggtagggatattgcatattatatgcagaggccgggtttcgaaccccg |
42108186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 170 - 218
Target Start/End: Complemental strand, 49750475 - 49750427
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
|||||||| |||||||| || ||||||||| |||| ||||||||||||| |
|
|
| T |
49750475 |
tcgtgagcttagctcagttgatagggatattgcatattatatgcagggg |
49750427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 218
Target Start/End: Original strand, 52575460 - 52575512
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
|||| ||||||| |||||||| ||||| | |||| |||||||||||||||||| |
|
|
| T |
52575460 |
gtccccgtgagcttagctcagttggtacgaatattgcattttatatgcagggg |
52575512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 146)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 173 - 237
Target Start/End: Original strand, 14396443 - 14396507
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||| |||||||| || |||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14396443 |
tgagcttagctcagttgatagggatatcacattttatatgcaggggtcggggttcgaaccccgaa |
14396507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 37662629 - 37662561
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| |||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
37662629 |
tcctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggtacgaaccccg |
37662561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 42490478 - 42490414
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
42490478 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccg |
42490414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 166 - 256
Target Start/End: Complemental strand, 9768910 - 9768820
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| || ||||| ||||||||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
9768910 |
gtccccgtgagcatagctcagttggcagggacat-gcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
9768820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 9866252 - 9866186
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| ||||||||| |||||| |
|
|
| T |
9866252 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaatcccgaa |
9866186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 35605691 - 35605629
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
35605691 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccc |
35605629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 17776850 - 17776903
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17776850 |
tagctcagttggtaggcatattgcattttatatgcaggggtcagggttcgaacc |
17776903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 6893305 - 6893241
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||||||||||||| | ||||||||||||| |
|
|
| T |
6893305 |
cgtgagcttagctcagttggtagggatattgcattttatatgcaggggccgaggttcgaaccccg |
6893241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 17671478 - 17671414
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| ||||||||||| | | |||||||||||| |
|
|
| T |
17671478 |
cgtgagcttagctcagttggtagggatatcgcatttcatatgcaggggccggagttcgaaccccg |
17671414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 21265658 - 21265722
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
21265658 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
21265722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 22563388 - 22563452
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
22563388 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
22563452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 29491463 - 29491551
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
29491463 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
29491551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 32594253 - 32594317
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
32594253 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccg |
32594317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 33207207 - 33207271
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
33207207 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
33207271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 6702578 - 6702641
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
6702578 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaacccc |
6702641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 18467266 - 18467203
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
18467266 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
18467203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 23393661 - 23393716
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23393661 |
ctcagttggtagggatatcacattttatatgcaggggtcgaggttcgaaccccgaa |
23393716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 172 - 227
Target Start/End: Original strand, 46225390 - 46225445
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttc |
227 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
46225390 |
gtgagcttagctcagttggtagggatattgcattttatatgcaggggtcggggttc |
46225445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 48638534 - 48638597
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
48638534 |
cgtgagcttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaacccc |
48638597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 179 - 257
Target Start/End: Complemental strand, 4069698 - 4069620
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||| ||||| ||||| ||||| |||||||||||| | ||||| |||||||| |||| |||||||||||||||| |
|
|
| T |
4069698 |
tagctcagttggtacagatattgcattatatatgcaggggccggggtttgaaccccggattctccacttattcacctta |
4069620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 173 - 235
Target Start/End: Complemental strand, 5190847 - 5190785
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| ||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
5190847 |
tgagcttagctcaattggtagggatatcgcatattatatgcaggggtcgaggttcgaaccccg |
5190785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 173 - 235
Target Start/End: Complemental strand, 6463102 - 6463040
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||| |||||||||||| | |||||||||||||||| | |||||||||||||| |
|
|
| T |
6463102 |
tgagcttagctcagttggtagggatattgtattttatatgcaggggccggggttcgaaccccg |
6463040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 8865856 - 8865918
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||||| || ||||||||| |
|
|
| T |
8865856 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcgggattcgaaccc |
8865918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 166 - 255
Target Start/End: Original strand, 18003810 - 18003899
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacct |
255 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| || ||||| ||||||||||||| | |||||||| ||||||| |||||||||||||||| |
|
|
| T |
18003810 |
gtccccgtgagcatagctcagttggcagggacat-gcattgttatatgcaggggccggggttcgagccccgaacaccccacttattcacct |
18003899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 170 - 235
Target Start/End: Complemental strand, 6712178 - 6712113
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||| ||||||| |||| |||||||||||||||||| | |||||| ||||||| |
|
|
| T |
6712178 |
tcgtgagcttagctcagttggtaggtatattgcattttatatgcaggggccggggttcaaaccccg |
6712113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 171 - 236
Target Start/End: Original strand, 8415731 - 8415796
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccga |
236 |
Q |
| |
|
||||||| |||||||| | |||||||||| |||| ||||||||||||||| |||||| |||||||| |
|
|
| T |
8415731 |
cgtgagcttagctcagttcgtagggatattgcatattatatgcaggggtcggggttcaaaccccga |
8415796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 235
Target Start/End: Original strand, 19924444 - 19924497
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| | ||| |||||||||||||| |
|
|
| T |
19924444 |
ctcagttggtagggatatcgcattttatatgcaagagtcggggttcgaaccccg |
19924497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 170 - 231
Target Start/End: Original strand, 20030079 - 20030140
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||| || ||||| ||||||| |||| |||||||||||||||||||| |||||||||| |
|
|
| T |
20030079 |
tcgtgagcttatctcagttggtaggaatattgcattttatatgcaggggtcggggttcgaac |
20030140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 1570260 - 1570196
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
1570260 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
1570196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 2277756 - 2277820
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
2277756 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
2277820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 6130101 - 6130041
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| |||||||||| |
|
|
| T |
6130101 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaac |
6130041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 6438132 - 6438068
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
6438132 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
6438068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 7166295 - 7166231
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
7166295 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccg |
7166231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 165 - 252
Target Start/End: Complemental strand, 11238130 - 11238043
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattca |
252 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||| || ||||| ||||||||||||||| ||||||||| |||| | ||||||||||||| |
|
|
| T |
11238130 |
agtcctcgtgagcatagctcagatggcatggacat-gcattattatatgcaggggtcggggttcgaatcccggacaccccacttattca |
11238043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 175 - 235
Target Start/End: Complemental strand, 12502318 - 12502258
Alignment:
| Q |
175 |
agcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||| |||||||||||| |||| ||||||||||| ||| ||||||||| |||| |
|
|
| T |
12502318 |
agcatagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaacccg |
12502258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 15819669 - 15819605
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
15819669 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
15819605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 16304330 - 16304394
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||| || || ||| |||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
16304330 |
cgtgagcttagcttagttgatagagatatcacattttatatgcagtggtcagggttcgaaccccg |
16304394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 16343030 - 16343094
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
16343030 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
16343094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 256
Target Start/End: Original strand, 19424066 - 19424130
Alignment:
| Q |
192 |
agggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||| |||| ||||||||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
19424066 |
agggataatgcatattatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
19424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 26584814 - 26584750
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
26584814 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccg |
26584750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 33254730 - 33254794
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| ||||| |||||||| |
|
|
| T |
33254730 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttggaaccccg |
33254794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 33274902 - 33274966
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| ||||| |||||||| |
|
|
| T |
33274902 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttggaaccccg |
33274966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 175 - 247
Target Start/End: Complemental strand, 36314043 - 36313971
Alignment:
| Q |
175 |
agcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
|||||||||||| |||||||||||| |||| |||| |||||||| | | |||||||||||||| |||||||| |
|
|
| T |
36314043 |
agcatagctcagttggtagggatattgcatattatttgcaggggccggagttcgaaccccgaacaccccactt |
36313971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 40375383 - 40375319
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||||||||||| | | |||| ||||||||| |
|
|
| T |
40375383 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggtacgaaccccg |
40375319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 46965742 - 46965806
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
46965742 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
46965806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 50899578 - 50899514
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
50899578 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
50899514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 1031621 - 1031672
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| ||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
1031621 |
ttatatgtaggggtcagagttcgaaccccgaacaccccacttattcacctta |
1031672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 11405490 - 11405541
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
11405490 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctta |
11405541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 24253782 - 24253837
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||||||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
24253782 |
tagctcatttggtagggatattgcatattatatgcaggggtcaaggttcgaacccc |
24253837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 25034906 - 25034969
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| ||||||| |||| |||||||||||| ||||| ||| ||||||||||| |
|
|
| T |
25034906 |
cgtgagcttagctcagttggtaggaatattgcattttatatgtaggggccagagttcgaacccc |
25034969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 41709991 - 41709928
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| ||||| || |||||||||||| || | |||||||||||||||| |||||||||||| |
|
|
| T |
41709991 |
cgtgagcttagcttagttggtagggatattgcgtgttatatgcaggggtcaaggttcgaacccc |
41709928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 251
Target Start/End: Original strand, 42908764 - 42908850
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattc |
251 |
Q |
| |
|
||||| ||||||| |||||||| ||| ||||| || ||||| ||||||||||||||| |||||||||| ||| || |||||||||||| |
|
|
| T |
42908764 |
agtccccgtgagcttagctcagttggcagggacat-gcattgttatatgcaggggtcggggttcgaactccggataccccacttattc |
42908850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 253
Target Start/End: Complemental strand, 47930732 - 47930657
Alignment:
| Q |
178 |
atagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||||||||||| ||||||||||| || || |||||||| ||||| |
|
|
| T |
47930732 |
atagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacctcggataccccacttcttcac |
47930657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 1836505 - 1836567
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| ||| |||||||||||||||| | ||||||||| |
|
|
| T |
1836505 |
cgtgagcttagctcagttggtagggatattacatattatatgcaggggtcaagattcgaaccc |
1836567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 256
Target Start/End: Complemental strand, 2903088 - 2903038
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
2903088 |
ttatatgcagaggtcggggttcgaaccccgaacaccccacttattcacctt |
2903038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 3269621 - 3269683
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
3269621 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccc |
3269683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 253
Target Start/End: Original strand, 6213431 - 6213505
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||| |||||||||||| |||| |||||| |||||||||||||| ||| |||| || |||||||| ||||| |
|
|
| T |
6213431 |
tagctcaattggtagggatattgcatattatatacaggggtcagggtttgaatcccggataccccacttcttcac |
6213505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 257
Target Start/End: Original strand, 9527417 - 9527511
Alignment:
| Q |
164 |
gagtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||||| ||||| |||||| | | ||||||||||||| |||| |
|
|
| T |
9527417 |
gagtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggtttgaaccctggacaccccacttattcatctta |
9527511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 18551701 - 18551635
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| ||||| |||||| |||| ||||||||||||| | ||||| |||||||||| |
|
|
| T |
18551701 |
cgtgagcttagctcagttggtatggatattgcatattatatgcaggggccggggtttgaaccccgaa |
18551635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 32556997 - 32556935
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||| |||||||||| ||| |||||| ||||| |
|
|
| T |
32556997 |
cgtgagcttagctcagctggtagggatattgcatattatatgcagaggttggggttcaaaccc |
32556935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 257
Target Start/End: Original strand, 32635151 - 32635225
Alignment:
| Q |
183 |
tcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| |||||| | ||||| ||||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
32635151 |
tcagctgctagggacactgcattatatatgcaggggttggggttcgaaccccggacaccccacttattcacctta |
32635225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 42054335 - 42054397
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||| ||||| | |||||||||||| |
|
|
| T |
42054335 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccc |
42054397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 217
Target Start/End: Complemental strand, 47402731 - 47402685
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggg |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
47402731 |
cgtgagcttagctcagctggtagggatattgcatattatatgcaggg |
47402685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 33130766 - 33130815
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||| ||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
33130766 |
tggtagggttattgcatattatatgcaggggtcggggttcgaaccccgaa |
33130815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 253
Target Start/End: Complemental strand, 52961184 - 52961096
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||| |||||||||||||||| ||| | ||| || ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
52961184 |
agtccccgtgagcatagctcagttggcaaggacat-gcattgttatatgcaggggccggggttcgaaccccggacgccccacttattcac |
52961096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 2754362 - 2754426
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||| || |||||||||||| |||| |||||||| |||| | |||||||||||||| |
|
|
| T |
2754362 |
cgtgagcttagcttagttggtagggatattgcatattatatgccggggccggggttcgaaccccg |
2754426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 4482666 - 4482602
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | | |||||||||||| |
|
|
| T |
4482666 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccg |
4482602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 10664862 - 10664799
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||| | ||| |||||||||||||| |
|
|
| T |
10664862 |
cgtgagcttagctcagttggtagggatattgcatattatatgca-gagtcggggttcgaaccccg |
10664799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 235
Target Start/End: Complemental strand, 13538502 - 13538450
Alignment:
| Q |
183 |
tcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
13538502 |
tcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
13538450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 17350054 - 17350142
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||| ||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
17350054 |
gtccccgtgagtatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
17350142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 18534003 - 18534067
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||| ||||| |||| ||||||| ||| ||| |||||||||||||| |
|
|
| T |
18534003 |
cgtgagcttagctcagttggtagagatattgcatattatatgtaggagtcggggttcgaaccccg |
18534067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 203 - 235
Target Start/End: Original strand, 18911885 - 18911917
Alignment:
| Q |
203 |
attttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18911885 |
attttatatgcaggggtcagggttcgaaccccg |
18911917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 256
Target Start/End: Original strand, 22779215 - 22779307
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggta-gggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||| ||||||| ||||| |||||| |||| || ||| |||| ||| ||||||||||||| || ||||||||||||||||| |
|
|
| T |
22779215 |
agtcctcgtgagcttagctcacttggtaagggataatgcatattttatacaggagtcggggttcgaaccccaaacaccccacttattcacctt |
22779307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 25819178 - 25819266
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||| ||| | | |||||||||||||| || |||||||||||||| |
|
|
| T |
25819178 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgtaggagccggggttcgaaccccggataccccacttattcac |
25819266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 25999852 - 25999916
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
25999852 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccg |
25999916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 246
Target Start/End: Original strand, 26438859 - 26438935
Alignment:
| Q |
171 |
cgtgagcatagctca-gctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccact |
246 |
Q |
| |
|
||||||||||||||| | ||||||||| ||| |||| |||||||||||||| |||||| || |||| ||| |||||| |
|
|
| T |
26438859 |
cgtgagcatagctcaagttggtagggacatcacattctatatgcaggggtcggggttcaaatcccggatttcccact |
26438935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 235
Target Start/End: Original strand, 27650695 - 27650763
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| || |||| |||||||||||| |||| |||||||||||| | | ||||||||||||| |
|
|
| T |
27650695 |
tcctcgtgagctaagttcagttggtagggatattgcatattatatgcagggataaaggttcgaaccccg |
27650763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 30360422 - 30360478
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| || |||||| ||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
30360422 |
tagcttagttggtagagatattgcattttatatgtaggggtcggggttcgaaccccg |
30360478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 34058216 - 34058280
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | ||||||||||||| |
|
|
| T |
34058216 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg |
34058280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 39238709 - 39238797
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | ||||||||||||| | |||||||||||||| |
|
|
| T |
39238709 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccgaggttcgaaccccggacaccccacttattcac |
39238797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 40678816 - 40678904
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | |||||||| ||||| | |||||||||||||| |
|
|
| T |
40678816 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgatccccggacaccccacttattcac |
40678904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 44019278 - 44019342
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||||||||||||| ||||| || |||||| |||| |
|
|
| T |
44019278 |
cgtgagcttagctcagttgatagggatattgcattttatatgcaagggtcgggattcgaatcccg |
44019342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 44732635 - 44732699
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||| ||| | |||||||||||||| |
|
|
| T |
44732635 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaagggccggggttcgaaccccg |
44732699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 235
Target Start/End: Original strand, 47088823 - 47088875
Alignment:
| Q |
183 |
tcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
47088823 |
tcagttggtagggatatcgtattttatatgcaggggctggggttcgaaccccg |
47088875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 538390 - 538339
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||| | | |||||||||||||| |||||||||||||||||| |
|
|
| T |
538390 |
ttatatgcaggggccggagttcgaaccccgaacaccccacttattcacctta |
538339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 179 - 234
Target Start/End: Original strand, 2556566 - 2556621
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
2556566 |
tagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
2556621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 207 - 246
Target Start/End: Original strand, 8310689 - 8310728
Alignment:
| Q |
207 |
tatatgcaggggtcagggttcgaaccccgaattccccact |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
8310689 |
tatatgcaggggtcagggttcgaaccccggataccccact |
8310728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 170 - 256
Target Start/End: Complemental strand, 8364505 - 8364419
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||| ||||| ||||||| | || ||||| ||||||| | ||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
8364505 |
tcgtgagcataactcagttggtaggaaaat-gcattattatatgtatgggtcggagttcgaaccccgaacgccccacttattcacctt |
8364419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 10851822 - 10851889
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||| | || ||||||||||||| | ||||||||||||| |
|
|
| T |
10851822 |
tcctcgtgagcttagctcaattggtaaggatattgtatattatatgcaggggacggggttcgaacccc |
10851889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 218
Target Start/End: Original strand, 11215003 - 11215050
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagggg |
218 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
11215003 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggg |
11215050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 165 - 247
Target Start/End: Original strand, 13763756 - 13763839
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatc-gcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||||||||| | |||||| ||||||||| | |||||||||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
13763756 |
agtcctcgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggctggggttcgaaccccggataccccactt |
13763839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 15774373 - 15774322
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||| ||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
15774373 |
ttatatgtaggggtcggggttcgaaccccggacaccccacttattcacctta |
15774322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 18923981 - 18923895
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| |||||||||||| |||||||||||||| || | |||||| ||||||||||| |
|
|
| T |
18923981 |
cgtgagcatagctcagttggtaggacaat-gcattattatatgcagggttcagggttcgaacctcggacaccccacgtattcacctta |
18923895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 19011357 - 19011420
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
19011357 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggggctggggttcgaacccc |
19011420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 174 - 252
Target Start/End: Original strand, 23750152 - 23750230
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattca |
252 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| |||||| || ||||| |||||| ||||| ||| ||||||||||||| |
|
|
| T |
23750152 |
gagcatagctcagttggtagggatat-gcattgttatatacatgggtcggggttcaaaccctgaacaccccacttattca |
23750230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 24910529 - 24910482
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||||||||||||| |
|
|
| T |
24910529 |
tggtagggatattgcataatttatgcaggggtcagggttcgaaccccg |
24910482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 27745156 - 27745242
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||||||| | || ||||| |||||||||||| || |||||||||||||| | ||||| |||||||||||| |
|
|
| T |
27745156 |
cgtgagcatagctcatttggtaggaaaat-gcattattatatgcagggatcggggttcgaaccccggacaccccatttattcacctta |
27745242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 226
Target Start/End: Complemental strand, 37626225 - 37626170
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggtt |
226 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37626225 |
cgtgagcttacctcagttggtagggatattatattttatatgcaggggtcagggtt |
37626170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 42831946 - 42832032
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| | || ||||| ||||||||||||| |||||| ||||||| | |||||||||||||||||| |
|
|
| T |
42831946 |
cgtgagcatagctcagttggtagg-acattgcattattatatgcaggggctggggttcaaaccccggacaccccacttattcacctta |
42832032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 257
Target Start/End: Complemental strand, 43837497 - 43837411
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||| ||||||| | || ||||| || |||||||||||| |||||||||||| | | ||||| |||||||||||| |
|
|
| T |
43837497 |
cgtgagcatagctcagttggtaggaaaat-gcattcttctatgcaggggtcggggttcgaaccctggacaccccatttattcacctta |
43837411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 166 - 256
Target Start/End: Complemental strand, 48260290 - 48260200
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||| | ||||| ||||||| |||||| | |||||||||||| | ||||||||||||||||| |
|
|
| T |
48260290 |
gtccccgtgagcatagctcagttggcagggatgt-gcattattatatgtcggggtcggagttcgaaccccggacaccccacttattcacctt |
48260200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 49251456 - 49251405
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
49251456 |
ttatatgcaggggtcggggttcgaaccccagacaccccacttattcacctta |
49251405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 182 - 256
Target Start/End: Complemental strand, 50199561 - 50199487
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||| ||||||||| || ||||| ||||||||||||| | |||||||||||||| | ||||||||||||||||| |
|
|
| T |
50199561 |
ctcagttggtagggacat-gcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
50199487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 51050192 - 51050255
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| | || ||||||||||||| ||||||||||||| |
|
|
| T |
51050192 |
cgtgagcttagctcagttggtagggatattgtatattatatgcaggggatggggttcgaacccc |
51050255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 257
Target Start/End: Original strand, 1721140 - 1721225
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
||||||||||||||| ||||||| | || ||||| ||||||||||||| | || ||||||||||| | || ||||||||||||||| |
|
|
| T |
1721140 |
gtgagcatagctcagttggtaggaacat-gcattgttatatgcaggggccgggtttcgaaccccggacacctcacttattcacctta |
1721225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 11065122 - 11065184
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| || ||| ||||| |||| ||||||||||||||| |||||| ||||| |
|
|
| T |
11065122 |
cgtgagcttagctcagatgatagagatattgcatattatatgcaggggtcggggttcaaaccc |
11065184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 247
Target Start/End: Complemental strand, 18607883 - 18607801
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||||||||| ||||| || ||||||||| || |||| | |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
18607883 |
agtcctcgtgagcttagctgagttggtagggacattgcataatttatgcaggggctggggttcgaaccccgaacaccccactt |
18607801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 234
Target Start/End: Original strand, 23233974 - 23234016
Alignment:
| Q |
192 |
agggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
|||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
23233974 |
agggatattgcatattatatgcaggggtcggggttcgaacccc |
23234016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 25580690 - 25580752
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| || ||||| |||||| ||||| |||| |||||||| || |||||||||||||||| |
|
|
| T |
25580690 |
cgtgagcttaactcagttggtagagatattgcatattatatgccggagtcagggttcgaaccc |
25580752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 217
Target Start/End: Complemental strand, 27642786 - 27642748
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggg |
217 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
27642786 |
tagctcagttggtagggatattgcattttatatgcaggg |
27642748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 43884804 - 43884858
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||| |
|
|
| T |
43884804 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccc |
43884858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 233
Target Start/End: Complemental strand, 47478920 - 47478854
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||||||| || ||||| |||||||||||| |||| ||||||| |||| || |||||| ||||| |
|
|
| T |
47478920 |
tcctcgtgagcttaactcagttggtagggatattgcatattatatgtagggatcggggttcaaaccc |
47478854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 257
Target Start/End: Complemental strand, 52202351 - 52202273
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||| |||||| |||| |||| ||||| | |||||| ||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
52202351 |
tagctcagttggtagagataatgcataatatatactggggtcggggttcgaatcccgaatacctcacttattcacctta |
52202273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 235
Target Start/End: Complemental strand, 30444 - 30399
Alignment:
| Q |
190 |
gtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||||| |||||||||||||||| | | |||||||||||||| |
|
|
| T |
30444 |
gtagggatattgcattttatatgcaggagccggggttcgaaccccg |
30399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 249
Target Start/End: Complemental strand, 2052785 - 2052700
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatttt-atatgcaggggtcagggttcgaaccccgaattccccacttat |
249 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||| | ||||| | ||||||||||| | |||||||||||||| | |||||||||| |
|
|
| T |
2052785 |
agtccccgtgagcatagctcagttggcagggacaatgcattatcatatgcaggggccggggttcgaaccccggacaccccacttat |
2052700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 256
Target Start/End: Complemental strand, 3341827 - 3341747
Alignment:
| Q |
176 |
gcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||| ||| ||||| || ||||| ||||||||||||| | ||| |||||||||| | ||||||||||||||||| |
|
|
| T |
3341827 |
gcatagctcagttggcagggacat-gcattattatatgcaggggccggggatcgaaccccggacaccccacttattcacctt |
3341747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 247
Target Start/End: Complemental strand, 30246097 - 30246016
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
|||| ||||||| ||||||| ||||||||| || |||| | ||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
30246097 |
gtccccgtgagcttagctcatttggtagggacattgcataattgatgcaggggtcgggattcgaaccccgaataccccactt |
30246016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 220
Target Start/End: Complemental strand, 32970860 - 32970819
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtc |
220 |
Q |
| |
|
|||||||| || ||||||||| |||||||||||||||||||| |
|
|
| T |
32970860 |
tagctcagttgatagggatattgcattttatatgcaggggtc |
32970819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 34656455 - 34656402
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||| || ||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
34656455 |
tagctcagttgatagagatattgcattttatatgcaggggttggggttcgaacc |
34656402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 216
Target Start/End: Complemental strand, 40519612 - 40519567
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
40519612 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
40519567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 235
Target Start/End: Original strand, 40634214 - 40634267
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
40634214 |
ctcagttggtagggatattgcatattatatgcaggggatggggttcgaaccccg |
40634267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 170 - 219
Target Start/End: Complemental strand, 42299582 - 42299533
Alignment:
| Q |
170 |
tcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggt |
219 |
Q |
| |
|
|||||||| ||| |||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
42299582 |
tcgtgagcttagttcagttggtagggatattgcatattatatgcaggggt |
42299533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 237
Target Start/End: Complemental strand, 47643044 - 47642984
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcatttt--atatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||||| |||||||||||| ||||||| |||||||| || | |||||||||||||||| |
|
|
| T |
47643044 |
tagctcagttggtagggatattgcattttatatatgcagaggccggggttcgaaccccgaa |
47642984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 621590 - 621642
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| || ||||||||| |||| || |||||||||||| ||||||||||||| |
|
|
| T |
621590 |
ctcagttgatagggatattgcatattttatgcaggggtcggggttcgaacccc |
621642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 1151761 - 1151825
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| |||||| |||| | | || ||||||||||| |
|
|
| T |
1151761 |
cgtgagcttagctcagttggtagggatattgcatattatatacaggagccgggattcgaaccccg |
1151825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 230
Target Start/End: Complemental strand, 3768034 - 3767982
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcat-tttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
3768034 |
tagctcagttggtagggatattgcatatttatatgcaggggttggggttcgaa |
3767982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 7180674 - 7180618
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||||||| |||| |||| ||||||||||||| | | |||||||||||| |
|
|
| T |
7180674 |
tagctcagttggtaggaatattgcatattatatgcaggggccggagttcgaaccccg |
7180618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 7191042 - 7191098
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| || ||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
7191042 |
tagctcagttgatagggatattgcatattatatgcaggggctggggttcgaaccccg |
7191098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 173 - 256
Target Start/End: Complemental strand, 9769674 - 9769591
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||||||||||| ||| ||||| || ||||| ||||||| |||| | |||||||||||||| | ||||||||||||||||| |
|
|
| T |
9769674 |
tgagcatagctcagttggcagggacat-gcattattatatgtagggattggggttcgaaccccggacaccccacttattcacctt |
9769591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 13773178 - 13773234
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | ||||||||| |||| |
|
|
| T |
13773178 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccg |
13773234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 14349654 - 14349710
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||| ||||| |||| ||||||| |||| || |||||||||||||| |
|
|
| T |
14349654 |
tagctcagttggtagagatattgcatattatatgtagggatcggggttcgaaccccg |
14349710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 16526245 - 16526181
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| ||||||||||| | | | |||||||||||| |
|
|
| T |
16526245 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggagcctgtgttcgaaccccg |
16526181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 258
Target Start/End: Complemental strand, 17056941 - 17056889
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttattcaccttac |
258 |
Q |
| |
|
||||||||||||| | ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
17056941 |
ttatatgcaggggccggggttcgaaccccagacgccccacttattcaccttac |
17056889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 17580327 - 17580379
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||| ||| |||||||||| |
|
|
| T |
17580327 |
tagctcagttggtagggatattgcatgttatatgcagaagtcggggttcgaac |
17580379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 26550496 - 26550560
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| |||||||||| | | |||||||||||||| |
|
|
| T |
26550496 |
cgtgagcttaactcagttggtagggatattgcatactatatgcaggagccggggttcgaaccccg |
26550560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 216
Target Start/End: Original strand, 27870950 - 27870978
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27870950 |
tggtagggatatcgcattttatatgcagg |
27870978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 29188646 - 29188702
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
29188646 |
tagctcagttggtagggatattgcatattatatgcaggagcaggggttcgaaccccg |
29188702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 35111643 - 35111730
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| || |||| | | ||||| ||||||||||||| | ||||||||||||| || |||||||||||||| |
|
|
| T |
35111643 |
gtccccgtgagcatagctcagttgataggaacaatgcattattatatgcagggg-cggggttcgaacccctaacaccccacttattcac |
35111730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 256
Target Start/End: Complemental strand, 35195686 - 35195622
Alignment:
| Q |
192 |
agggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||| |||| |||||||||||| |||||||||||||||| | | ||||||||||||||| |
|
|
| T |
35195686 |
agggataatgcatattatatgcagggaccagggttcgaaccccgtacactccacttattcacctt |
35195622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 36666644 - 36666580
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| ||||||||| || |||| | |||||||||| | |||||||||||||| |
|
|
| T |
36666644 |
cgtgagcttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccg |
36666580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 253
Target Start/End: Original strand, 38021245 - 38021333
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||| |||||||||||||||| ||| | ||| | ||||| ||||||||||||| | | |||||||||||| | |||||||||||||| |
|
|
| T |
38021245 |
gtccccgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcac |
38021333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 45517336 - 45517272
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| ||| |||| |||||||||||| ||||||||||| |||||| | || || |||||||| |
|
|
| T |
45517336 |
cgtgagcttagttcagttggtagggatattgcattttatatacaggggccgggattggaaccccg |
45517272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 46021947 - 46021883
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
46021947 |
cgtgagcgtagctcagtaagtagggatattgcatattatatgcaggagccggggttcgaaccccg |
46021883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 48897185 - 48897125
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| || |||| ||||||| |||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
48897185 |
cgtgagcttaactcatttggtaggaatattgcatattatatgcaggggccagggttcgaac |
48897125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 50746721 - 50746777
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||||||||||||| ||| ||||||| || |||| || ||||||||||| |
|
|
| T |
50746721 |
tagctcagttggtagggatatcacatattatatgtagaggtcgggattcgaaccccg |
50746777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 52426981 - 52426921
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||| ||||||||||||| | ||||||||| |
|
|
| T |
52426981 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccgtggttcgaac |
52426921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 237
Target Start/End: Original strand, 8823 - 8888
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
8823 |
cgtgagcttagctcagttggtagggatattgcattttatatgca-gggtcggggttcgaaccccgaa |
8888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 10894 - 10830
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
10894 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccg |
10830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 167 - 235
Target Start/End: Complemental strand, 28002 - 27934
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| |||||| | |||||||||||| |||||||||||||||||| | |||||||| ||||| |
|
|
| T |
28002 |
tcctcgtgagcttagctcggttggtagggatattgcattttatatgcaggggccggggttcgatccccg |
27934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 234
Target Start/End: Complemental strand, 4082 - 4019
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
4082 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaacccc |
4019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 101830 - 101916
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctta |
257 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| ||||||||||||| | ||||||||||||| || ||||||||||||||||| |
|
|
| T |
101830 |
cgtgagcatagctcagctggtagg-ataatgcattattatatgcaggggccggggttcgaaccccaaacatcccacttattcacctta |
101916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 3)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 169 - 231
Target Start/End: Complemental strand, 2569 - 2508
Alignment:
| Q |
169 |
ctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||||| ||||||| || |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2569 |
ctcgtgagcttagctcaattgttagggatatcgcattttatatgcaggggtc-gggttcgaac |
2508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 46528 - 46591
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
46528 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacccc |
46591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 235
Target Start/End: Original strand, 11992 - 12060
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||| | |||||||| |||||||||||| |||| ||||||||||| | | ||||| |||||||| |
|
|
| T |
11992 |
tcctcgtgaacttagctcagttggtagggatattgcatattatatgcaggagccggggtttgaaccccg |
12060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 172 - 253
Target Start/End: Original strand, 12564 - 12646
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||||||||||||| ||| ||||| | ||||| ||||||||||||||||||||||||||| || || ||||| |||||||| |
|
|
| T |
12564 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcagggttcgaacctcggataccccatttattcac |
12646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 12461 - 12525
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
12461 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccg |
12525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 13263 - 13207
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
13263 |
tagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccg |
13207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 928 - 864
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
928 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 235
Target Start/End: Original strand, 15762 - 15830
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||||||| || ||||| |||||||||||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
15762 |
tcctcgtgagcttatctcagttggtagggatattgcatattatatgcaggagtcgaggttcgaaccccg |
15830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 94661 - 94717
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||||| |||||| |||| | |||||||||||||||||||||||||||| |
|
|
| T |
94661 |
tagctcagttggtatggatattgcatgtcatatgcaggggtcagggttcgaaccccg |
94717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 59785 - 59849
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
59785 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
59849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 88 - 26
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccc |
233 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | |||||||||||| |
|
|
| T |
88 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccc |
26 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 253
Target Start/End: Original strand, 7068 - 7157
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||| |||||||||||||||| || |||||| | ||||| ||||||||||||| | |||||||||||||| | ||||| |||||||| |
|
|
| T |
7068 |
agtccccgtgagcatagctcagttgttagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccatttattcac |
7157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 1874 - 1930
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||| | ||||||||||||| |
|
|
| T |
1874 |
tagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccg |
1930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 3668 - 3732
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| || ||||| |||||||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
3668 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggaaccagggttcgaaccccg |
3732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 8968 - 9032
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | | |||||||||||| |
|
|
| T |
8968 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccg |
9032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0276 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 172 - 232
Target Start/End: Original strand, 1263 - 1323
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||| |||||||||||||||| |||| |||||||||||| ||||| | |||||| |||| |
|
|
| T |
1263 |
gtgagcttagctcagctggtaggaatattgcattttatatgtaggggccggggttcaaacc |
1323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 247
Target Start/End: Original strand, 15007 - 15083
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccactt |
247 |
Q |
| |
|
||||||| |||||||| ||||||||| || |||| | ||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
15007 |
cgtgagcttagctcagttggtagggacattgcataatttatgcaggggtcatggttcgaaccccaaacaccccactt |
15083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 11180 - 11124
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
11180 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
11124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 21508 - 21452
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||| | | |||||||||||||| |
|
|
| T |
21508 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccg |
21452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 17622 - 17686
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
17622 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccg |
17686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 315659 - 315715
Alignment:
| Q |
179 |
tagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
315659 |
tagctcagttggtaaggatattgcattttatatgcaggggtcgatgttcgaaccccg |
315715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 21266 - 21329
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||||| ||||| || |||||||||||| |||| |||||||||||||| || |||||||||| |
|
|
| T |
21266 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggggttgggtttcgaacccc |
21329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 174 - 256
Target Start/End: Original strand, 16849 - 16930
Alignment:
| Q |
174 |
gagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
||||||||||||| ||||||| || ||||| ||||||||||||||| |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
16849 |
gagcatagctcagttggtaggacaat-gcattattatatgcaggggtc-gggttcgaaccccgaacaccctacttattcacctt |
16930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 166 - 252
Target Start/End: Original strand, 25019 - 25106
Alignment:
| Q |
166 |
gtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattca |
252 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
25019 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattca |
25106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 253
Target Start/End: Original strand, 39665 - 39730
Alignment:
| Q |
188 |
tggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||| |||| || |||||||| ||||| |
|
|
| T |
39665 |
tggtagggatattgcatattatatgcaggggttggggttcgagccccagataccccacttcttcac |
39730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 65854 - 65791
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||| ||||||| |||||| ||||||||| |||| |
|
|
| T |
65854 |
gtgagcttagctcagttggtagggatattgcatattatatgtaggggttggggttcgaatcccg |
65791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 171 - 230
Target Start/End: Complemental strand, 266765 - 266706
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaa |
230 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| | | ||||||||| |
|
|
| T |
266765 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaa |
266706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 175 - 236
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||||| ||||| ||||| |||| ||||||||||||| | ||||||||||||| |
|
|
| T |
175 |
tgagcttagctcagttggtatagatattgcatattatatgcaggggccggggttcgaacccc |
236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 146 - 85
Alignment:
| Q |
173 |
tgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaacccc |
234 |
Q |
| |
|
||||| |||||||| ||||| ||||| |||| ||||||||||||| | ||||||||||||| |
|
|
| T |
146 |
tgagcttagctcagttggtatagatattgcatattatatgcaggggccggggttcgaacccc |
85 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 216
Target Start/End: Complemental strand, 2441 - 2396
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
2441 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
2396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 237
Target Start/End: Complemental strand, 3660 - 3595
Alignment:
| Q |
172 |
gtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccgaa |
237 |
Q |
| |
|
|||||| |||||||| |||||||||||| ||| |||||||| || ||| | |||||||||||||| |
|
|
| T |
3660 |
gtgagcttagctcagttggtagggatatttcatattatatgccggagtccgtgttcgaaccccgaa |
3595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 253
Target Start/End: Complemental strand, 4908 - 4820
Alignment:
| Q |
165 |
agtcctcgtgagcatagctcagctggtagggatatcgcatt-ttatatgcaggggtcagggttcgaaccccgaattccccacttattcac |
253 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||| | ||||| ||||||||||||| | ||||||||| |||| | |||||||||||||| |
|
|
| T |
4908 |
agtccccgtgagcatagctcagttggcagggacaatgcattattatatgcagggg-cggggttcgaatcccggacaccccacttattcac |
4820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 235
Target Start/End: Complemental strand, 17318 - 17265
Alignment:
| Q |
182 |
ctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||| || ||||||||| |||||||| ||||||||| | |||||||||||||| |
|
|
| T |
17318 |
ctcagttgatagggatattgcattttacatgcaggggccggggttcgaaccccg |
17265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 256
Target Start/End: Original strand, 1031 - 1123
Alignment:
| Q |
164 |
gagtcctcgtgagcatagctcagctggtagggatatcgcat-tttatatgcaggggtcagggttcgaaccccgaattccccacttattcacctt |
256 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||| || |||| ||||||| ||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
1031 |
gagtccccgtgagcatagctcagttggtagggacat-gcataattatatgtaggggctggggttcgaaccccagacaccccacttattcacctt |
1123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 37486 - 37437
Alignment:
| Q |
167 |
tcctcgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
216 |
Q |
| |
|
||||||||||| || ||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
37486 |
tcctcgtgagcttaactcagttggtagggatattgcatattatatgcagg |
37437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 8984 - 8921
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgc--aggggtcagggttcgaacc |
232 |
Q |
| |
|
|||||||||| |||| |||||||||||| |||| |||||||| ||||||| ||||||||||| |
|
|
| T |
8984 |
cgtgagcataactcaattggtagggatattgcatattatatgcagaggggtcggggttcgaacc |
8921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 50069 - 50009
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaac |
231 |
Q |
| |
|
||||||| || ||||| || ||||||||| |||| ||||||| |||||| ||||||||||| |
|
|
| T |
50069 |
cgtgagcttaactcagttgatagggatattgcatattatatgtaggggttagggttcgaac |
50009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 245517 - 245473
Alignment:
| Q |
206 |
ttatatgcaggggtcagggttcgaaccccgaattccccacttatt |
250 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
245517 |
ttatatgcaggggtcggggttcgaaacccgaacaccccacttatt |
245473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 171 - 235
Target Start/End: Complemental strand, 8893 - 8829
Alignment:
| Q |
171 |
cgtgagcatagctcagctggtagggatatcgcattttatatgcaggggtcagggttcgaaccccg |
235 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||| || |||||||||| | ||| | |||||||| |
|
|
| T |
8893 |
cgtgagcttagctcagttggtagggatattgcatattttatgcaggggccgggggttgaaccccg |
8829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University