View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10682_low_12 (Length: 254)
Name: NF10682_low_12
Description: NF10682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10682_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 29 - 209
Target Start/End: Original strand, 42523752 - 42523935
Alignment:
| Q |
29 |
aatagccgttctcatggccaacat---ctctaaacattataagatgggggttccaatctgatgaggtggatttggcgtgtcacactgtcaccatgacttc |
125 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42523752 |
aatagccgttctcatggccaacatgatctctaaacattataagatgggggttccaatctgatgaggtggatttggcgtgtcacactgtcaccatgacttc |
42523851 |
T |
|
| Q |
126 |
ttattagcctacataacatgattcagacttcattctgttgaccccacactaccatgtgaaactcagacccaccccctgattctg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42523852 |
ttattagcctacataacatgattcagacttcattctgttgaccccacactaccatgtgaaactcagacccaccccctgattctg |
42523935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 213 - 241
Target Start/End: Original strand, 42523927 - 42523955
Alignment:
| Q |
213 |
ctgattctgtgcaaggaatgtactactct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42523927 |
ctgattctgtgcaaggaatgtactactct |
42523955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University