View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10683_low_10 (Length: 251)
Name: NF10683_low_10
Description: NF10683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10683_low_10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 3953922 - 3953689
Alignment:
| Q |
18 |
ccttagtaggatcccgggttcaaagtttgatgttgcctacatttttcgtctatagaagctttcaacaaggtgatttctctttaggcacctcaaaagtaac |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3953922 |
ccttagtaggatcacgggttcaaagtttgatgttgcctacatttttcgtctatagaagctttcaacaaggtggtttctctttaggcacctcaaaagtaac |
3953823 |
T |
 |
| Q |
118 |
gaatggtagctgattaccgttcagataacttttttagatcactactatataccaatttaaaaattgatttgaatggtaattaactgccgttgggtaggtg |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3953822 |
gaatggtagctgattaccgttcaaataac-tttttagatcactactatataccgatttaaaaattgatttgaatggtaattaactgccgttggataggtg |
3953724 |
T |
 |
| Q |
218 |
cctgtgagcaatctct-aagtgcctaaacagtaat |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| |
|
|
| T |
3953723 |
cctgtgagcaatctctaaagtgcctaaagagtaat |
3953689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University