View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10683_low_14 (Length: 212)

Name: NF10683_low_14
Description: NF10683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10683_low_14
NF10683_low_14
[»] chr2 (1 HSPs)
chr2 (166-201)||(13811942-13811977)


Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 201
Target Start/End: Complemental strand, 13811977 - 13811942
Alignment:
166 ttacaagtggttattttaatcttttctaccattctt 201  Q
    ||||||||||||||||||||||||||||||||||||    
13811977 ttacaagtggttattttaatcttttctaccattctt 13811942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University