View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10683_low_9 (Length: 263)
Name: NF10683_low_9
Description: NF10683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10683_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 25303913 - 25303670
Alignment:
| Q |
1 |
ctggtgtctgataatggttatttggttatgagataggagcacctatgtgatgtagcaaagaattattttgatgtggtttttgcggccaacaatggtaacc |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25303913 |
ctggtgtttgataatggttatttggttatgagataggagcacctatgtgatgtagcaaataattattttgatgtggtttttgcagccaacaatggtaacc |
25303814 |
T |
|
| Q |
101 |
atacgcatgttcttgattttctaaagtgtgtgggttacccacgaatacaatgatatgcttatgacactgattactagaaaagagcgcaaacatgccctat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25303813 |
atacgcatgttcttgattttctaaagtgtgtgggttacccacgaatacaatgatatgcttatgacactgattactagaaaagagctcaaacatgccctat |
25303714 |
T |
|
| Q |
201 |
ttcaaatgcaacctgataagtccccaaggtctgatggatttaat |
244 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
25303713 |
ttcaaatgcaacctgataagtcctcgaggtctgatggatttaat |
25303670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University