View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10685_high_2 (Length: 248)
Name: NF10685_high_2
Description: NF10685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10685_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 29672074 - 29671854
Alignment:
| Q |
19 |
gagcagcctactatgatgcatgacttcgcgatcactgagaatttcgttgttgtgcctgatcaacaagttgtgtttaaattgggtgaaatgatccgtggtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672074 |
gagcagcctactatgatgcatgacttcgcgatcactgagaatttcgttgttgtgcctgatcaacaagttgtgtttaaattgggtgaaatgatccgtggtg |
29671975 |
T |
 |
| Q |
119 |
ggtcgcctgttgtttacgataaggagaaagtctcgaggttcggggttttatcaaagaatgctgaagattcttctgagatgatttggattgatgcaccaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671974 |
ggtcgcctgttgtttacgataaggagaaagtctcgaggttcggggttttatccaagaatgctgaagattcttctgagatgatttggattgatgcaccaga |
29671875 |
T |
 |
| Q |
219 |
gtgtttctgttttcatctgtg |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29671874 |
gtgtttctgttttcatctgtg |
29671854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University