View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10686_high_19 (Length: 203)
Name: NF10686_high_19
Description: NF10686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10686_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 42771475 - 42771663
Alignment:
| Q |
15 |
agttaccacttagattattatatttgcattttgacttttcttaagggaaaa-aataccacataaccttctatcagttaggatttcataaacaagaaaagt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42771475 |
agttaccacttagattattatatttgcattttgacttttcttaagggaaaaaaataccacatcaccttctatcagttaggatttcatcaacaagaaaagt |
42771574 |
T |
 |
| Q |
114 |
aattagtcatccaaagc------ttgaattaagatcataattacatgctactactgtctttattgcttggtttggtctctgcttctcca |
196 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||| |
|
|
| T |
42771575 |
aattaatcatccaaagcttaattttgaattaagatcataattacatgctactactgtctttattgcttggtttggtgtgtgcctctcca |
42771663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University