View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10686_high_6 (Length: 329)
Name: NF10686_high_6
Description: NF10686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10686_high_6 |
 | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 142 - 325
Target Start/End: Complemental strand, 348758 - 348575
Alignment:
| Q |
142 |
cagttgttcttgtcttgtcttatcttgtcgccggaaaaaacatgttcagagacgtgtcaagttgcaacacctatgattacggtgatgctcattactggga |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
348758 |
cagttgttcttgtcttgtcttatcttgtcgccggaaaaaacatgttcagagacgtgtcaagttgcaacacctatgattacggtgatgctcattactggga |
348659 |
T |
|
| Q |
242 |
cgctcgttacattcaagagggtggttcttttgattggtatcagcgttactctaatcttaaaccttttcttcgtctctgcttctc |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
348658 |
cgctcgttacattcaagagggtggttcttttgattggtatcagcgttactctaatcttaaaccttttcttcgtcactgtttctc |
348575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 348881 - 348844
Alignment:
| Q |
19 |
gtttagtactttagttagttgaagtgtgtttgattatt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
348881 |
gtttagtactttagttagttgaagtgtgtttgattatt |
348844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University