View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10686_low_11 (Length: 287)
Name: NF10686_low_11
Description: NF10686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10686_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 29848292 - 29848026
Alignment:
| Q |
1 |
gaaggggtttttatcgggagatttaaattctaaaaacagacataatcacctacttactaacactttttctataaaaatattaaggtctaaattaatatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29848292 |
gaaggggtttttatcgggagatttaaattctaaaaacagacataatcacctacttactaacactttt-ctataaaaatattaaggtctaaattaatatat |
29848194 |
T |
|
| Q |
101 |
tttttgtgccctaaaatatatcaagttttgcatttttaaaaaccatcgcatgcttttgtctctacaaatttcctccttaaaatattggaatgatgctctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29848193 |
tttttgtgccctaaaatatatcaagttttgcatttttaaaaaccatcgcatgcttttgtctctacaaatttcctccttaaaatattggaatgatactctc |
29848094 |
T |
|
| Q |
201 |
tctatgcaaggttgatctgaactagttggaaatactggacgaagagtcgtatgcttctaagacactca |
268 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29848093 |
tctatgcaaggttgatttgaactagttggaaatactggacgaagagtcgtatgcttctaagacactca |
29848026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University