View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10686_low_14 (Length: 248)

Name: NF10686_low_14
Description: NF10686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10686_low_14
NF10686_low_14
[»] chr4 (1 HSPs)
chr4 (1-248)||(28690619-28690861)


Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 28690619 - 28690861
Alignment:
1 ggagaagcataggaacttggaccctttttcccccaaaatagcagccaacctaagctcaagttgaacccatattcttggaataaaggtgggtcaatttc-- 98  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
28690619 ggagaagcagaggaacttggaccctttttcccccaaaatagcagccaacctaagctcaagttgaacccatattcttggaataaaggtgggtcaatttcaa 28690718  T
99 -aaattgataactttcacaatgcattgcaataatggtagttcaattcattgtaaatttgttaatttgagataaactttgtatatcctgtacaattttaaa 197  Q
     ||||||||||||||||||||||||||||| ||||||||||||||||||||||        |||||||||||||||||||||||| ||||||||||||||    
28690719 taaattgataactttcacaatgcattgcaaaaatggtagttcaattcattgta--------aatttgagataaactttgtatatcttgtacaattttaaa 28690810  T
198 aataaactaaatcttttctacagctgcaaatcttttgtttcttgaatcccc 248  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
28690811 aataaactaaatcttttctacagctgcaaatcttttgtttcttgaatcccc 28690861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University