View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10686_low_15 (Length: 247)
Name: NF10686_low_15
Description: NF10686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10686_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 29425069 - 29424841
Alignment:
| Q |
1 |
ttggataaattgataaccatgctgaagcagcctgcatgtgtaatatagtgtagagcaacaatgtgaataccctttgnnnnnnnnnnnnncataactacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
29425069 |
ttggataaattgataaccatgctgaagcagcctgcatgtgtaatatagtgtagagcaacaatgttaataccctttgaaaaaattaaaaacataactacta |
29424970 |
T |
 |
| Q |
101 |
agacattatatatggttgtaatagcaattatattatcacgcacatacctttgggccaataggtattccattgcgctggcctgtggnnnnnnntataatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29424969 |
agacattatatatggttgtaatagcaattatattatcacgcacatacctttgggccaataggtattccattgcgctggcctgtggaaaaaaatataatat |
29424870 |
T |
 |
| Q |
201 |
gatagtctattgctaacaaaaatacatgt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29424869 |
gatagtctattgctaacaaaaatacatgt |
29424841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University