View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10686_low_16 (Length: 242)
Name: NF10686_low_16
Description: NF10686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10686_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 188473 - 188236
Alignment:
| Q |
1 |
ttgcatttattttcttagttagactagactcacatcgtgtgatgatat---------------tttattagttaattaattaatttatattatagatatc |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
188473 |
ttgcatttattttcttagttagactagactcacatcgtgtgatgatatgtatggtgctgatattttattagttaattaattaatttatattata----tc |
188378 |
T |
|
| Q |
86 |
caaagtgaatatgtgtttgtttgtt----ggttggcaatgcattggcaggttgaaggaagaactgtgaaagctcagatatgggacactgccgggcaggaa |
181 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
188377 |
caaagtgaatatgtgtttgtttgtttgttggttggcaatgcattggcaggttgaaggaagaactgtgaaagctcagatatgggacactgccgggcaggaa |
188278 |
T |
|
| Q |
182 |
cgctacagagccattaccagtgcctactatcgcggtgccctc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
188277 |
cgctacagagccattaccagtgcctactatcgcggtgccctc |
188236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University