View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10686_low_19 (Length: 240)
Name: NF10686_low_19
Description: NF10686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10686_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 79 - 223
Target Start/End: Original strand, 29425552 - 29425692
Alignment:
| Q |
79 |
gtgcaatttccttctttatctaattaatctatggcatatgtatatgtttaattaatgtatccaaatcttttaccagggatggtgtgaatgtaaaagggta |
178 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29425552 |
gtgcaatttccttatttatctaattaatctatgacatatgtatatgtttaa----tgtatccaaaaattttaccagggatggtgtgaatgtaaaagggta |
29425647 |
T |
 |
| Q |
179 |
ttttgcatggtcattgcttgataactttgaatggggtttaggcta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29425648 |
ttttgcatggtcattgcttgataactttgaatggggtttaggcta |
29425692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 196
Target Start/End: Original strand, 29408368 - 29408412
Alignment:
| Q |
152 |
cagggatggtgtgaatgtaaaagggtattttgcatggtcattgct |
196 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29408368 |
cagggatggtgtgaatgtaaaaggatattttgcatggtcattgct |
29408412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 152 - 213
Target Start/End: Complemental strand, 25044620 - 25044559
Alignment:
| Q |
152 |
cagggatggtgtgaatgtaaaagggtattttgcatggtcattgcttgataactttgaatggg |
213 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||| | |||||| | ||||||| |
|
|
| T |
25044620 |
cagggatggtgtgaatgtaaagggatattttgcatggtcattgttggataacatggaatggg |
25044559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 152 - 213
Target Start/End: Complemental strand, 24984552 - 24984491
Alignment:
| Q |
152 |
cagggatggtgtgaatgtaaaagggtattttgcatggtcattgcttgataactttgaatggg |
213 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||||||||||| | |||||| |||||||| |
|
|
| T |
24984552 |
cagggaaggtgtgaatgtaaagggatattttgcatggtcattgttggataaccatgaatggg |
24984491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 213
Target Start/End: Original strand, 25002427 - 25002488
Alignment:
| Q |
152 |
cagggatggtgtgaatgtaaaagggtattttgcatggtcattgcttgataactttgaatggg |
213 |
Q |
| |
|
||||||||| ||||||||||| || || ||||| ||||| ||| | |||||||||||||||| |
|
|
| T |
25002427 |
cagggatggcgtgaatgtaaagggatactttgcgtggtcgttgttggataactttgaatggg |
25002488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 42154749 - 42154702
Alignment:
| Q |
165 |
aatgtaaaagggtattttgcatggtcattgcttgataactttgaatgg |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || || ||||||||| |
|
|
| T |
42154749 |
aatgtaaaaggatattttgcatggtcattgctcgacaattttgaatgg |
42154702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University