View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10686_low_23 (Length: 225)
Name: NF10686_low_23
Description: NF10686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10686_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 46770186 - 46770016
Alignment:
| Q |
1 |
gtttcgtttttgcaaaaattgaatggttagagcctttaaatctaattgttatcggctagcaagagttgtgatattgattttgagccggatagcgaagaaa |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46770186 |
gtttcgtttttgctaaaattgaatggttagagcctttaaatctaattgttatcggctagcaagagttgtgatattgattttgagccggatagcaaagaaa |
46770087 |
T |
|
| Q |
101 |
ggtggatgattttcacaatcctcaagatgatgtgtcatattttgattcaattcttattgatcgtaggcata |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
46770086 |
ggtggatgattttcacaatcctcaagatgatgtgtcatattttgattcaattcttattaattgtaggcata |
46770016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University