View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10689_4 (Length: 520)
Name: NF10689_4
Description: NF10689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10689_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 26 - 331
Target Start/End: Complemental strand, 488498 - 488186
Alignment:
| Q |
26 |
ggaagggaggataggagtgaggcagaagagatgatagccgttgtcgcaattgtcgcagagaagcaacttagttggggatttgccggagttgcatttctgg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488498 |
ggaagggaggataggagtgaggcagaagagatgatagccgttgtcgcaattgtcgcagagaagcaacttagttggggatttgccggagttgcatttctgg |
488399 |
T |
|
| Q |
126 |
caaactacgtcgtcgtcgttgttgttgaaggtcgtggattgttttttgggagctggaattcttcttcggcgaagtggtgaagccatggtgagatttggga |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
488398 |
caaactacgtcgtcgtcgttgttgttgaaggtcgtggattgttttttgggagctggaattcttcttcggcgaagtggtgaaaccatggtgagatttggga |
488299 |
T |
|
| Q |
226 |
tttgagaatgaatcggcgttgtttgtgtaagaaatga-------gaaaggagaatgaggaataataggttttgtaattaagtaagaattggaagaggcgt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488298 |
tttgagaatgaatcggcgttgtttgtgtaagaaatgagaaatgagaaaggagaatgaggaataataggttttgtaattaagtaagaattggaagaggcgt |
488199 |
T |
|
| Q |
319 |
tttcgcggggtta |
331 |
Q |
| |
|
||||||||||||| |
|
|
| T |
488198 |
tttcgcggggtta |
488186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 426 - 520
Target Start/End: Complemental strand, 488110 - 488016
Alignment:
| Q |
426 |
aacgtaaaaggttattcaattcaatgttattaaaatcatttactaaactcttgtttttgacaaattataaaaatgtctttttgacttaaaaaggt |
520 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488110 |
aacgtaaaaggttattcaattcaatgttattaaaattatttactaaactcttgtttttgacaaattataaaaatgtctttttgacttaaaaaggt |
488016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 45 - 139
Target Start/End: Complemental strand, 500576 - 500482
Alignment:
| Q |
45 |
aggcagaagagatgatagccgttgtcgcaattgtcgcagagaagcaacttagttggggatttgccggagttgcatttctggcaaactacgtcgtc |
139 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
500576 |
aggcagaagagatggtagcctttgttgcaattgtcgcaaagaagcaacttggttggggatttgccggagttgcatttctggcaaacaatgtcgtc |
500482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 431 - 477
Target Start/End: Complemental strand, 488022 - 487976
Alignment:
| Q |
431 |
aaaaggttattcaattcaatgttattaaaatcatttactaaactctt |
477 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
488022 |
aaaaggttattcaattcaatgttattaatatcatttactaaactctt |
487976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University