View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10689_high_1 (Length: 249)
Name: NF10689_high_1
Description: NF10689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10689_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 5401484 - 5401246
Alignment:
| Q |
1 |
cagactggtgccaagcactatgtaggaccctttgaaatcatcggtaagatcaaacctcacgagtcccccttcacagagaacgtgccacgtctcgacacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| | |||||||| |||||||||| |
|
|
| T |
5401484 |
cagactggtgccaagcactatgtaggacccttcgaaatcatcggtaagatcaaacctcatgagtcccccttcacagaggatgtgccacgcctcgacacac |
5401385 |
T |
|
| Q |
101 |
ccaatttctattacacattagaggatatcttgttcgaagaggttagtgcattacacattattctcattagccttttatttcaatggtaatatacaaaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5401384 |
ccaatttctattacacattagaggatatcttgttcgaagaggttagtgcattacacattattctcattagccttttatttcaatggtaatatacaaaata |
5401285 |
T |
|
| Q |
201 |
ccctaagaagctcacatttgtccacttttttcctttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5401284 |
ccctaagaagctcacatttgtccacttttttcctttcat |
5401246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 13 - 151
Target Start/End: Complemental strand, 5395325 - 5395187
Alignment:
| Q |
13 |
aagcactatgtaggaccctttgaaatcatcggtaagatcaaacctcacgagtcccccttcacagagaacgtgccacgtctcgacacacccaatttctatt |
112 |
Q |
| |
|
|||||||| ||||| |||| |||| |||||||||||||| | || |||||||||||||| ||| | |||||||| || | ||||||||||||||||| |
|
|
| T |
5395325 |
aagcactacctaggatccttcgaaacgatcggtaagatcaaggcccatgagtcccccttcacggaggatgtgccacgccttgtcacacccaatttctatt |
5395226 |
T |
|
| Q |
113 |
acacattagaggatatcttgttcgaagaggttagtgcat |
151 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
5395225 |
acacacaggaggatatcttgttagaagaggttggtgcat |
5395187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 144
Target Start/End: Complemental strand, 5391515 - 5391383
Alignment:
| Q |
12 |
caagcactatgtaggaccctttgaaatcatcggtaagatcaaacctcacgagtcccccttcacagagaacgtgccacgtctcgacacacccaatttctat |
111 |
Q |
| |
|
||||||||| | ||| |||||||||| ||||||||||||| || || |||||||| ||||| ||| | |||||||| || | |||||||||||||||| |
|
|
| T |
5391515 |
caagcactactttggatcctttgaaatagtcggtaagatcaagccccatgagtcccctttcacggaggatgtgccacgccttgtcacacccaatttctat |
5391416 |
T |
|
| Q |
112 |
tacacattagaggatatcttgttcgaagaggtt |
144 |
Q |
| |
|
||||| ||||||||||||| | ||||||||| |
|
|
| T |
5391415 |
cacacacaagaggatatcttgctagaagaggtt |
5391383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University