View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1068_high_14 (Length: 262)

Name: NF1068_high_14
Description: NF1068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1068_high_14
NF1068_high_14
[»] chr1 (1 HSPs)
chr1 (162-233)||(7254217-7254288)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 162 - 233
Target Start/End: Complemental strand, 7254288 - 7254217
Alignment:
162 atgaagtaatcaattaataagtacttattgtcaataaataaaatttgaagtacctgtttgtaagaataatct 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
7254288 atgaagtaatcaattaataagtacttattgtcaataaataaaatttgaagtacctgtttgtaagaagaatct 7254217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University