View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1068_high_16 (Length: 251)
Name: NF1068_high_16
Description: NF1068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1068_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 245
Target Start/End: Complemental strand, 3900750 - 3900515
Alignment:
| Q |
10 |
gcagagagcatagtcgataatgggattacgtttttcaagtgatatctattgtcgaagatttctcctagaaagtaattgtgagaatatgatgttaggttga |
109 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3900750 |
gcagagagcatggtcgataatgggattacgtttttcaagagatatctattgtcgaagatttctcctagaaagtaattgtgagaatatgatgctaggttga |
3900651 |
T |
|
| Q |
110 |
gcaaaaccaaagtgttacgttgctatttcatttcctcacttagagaatgtttgaccttttctgatttatacgagtcaatatctcatatcaaatatagtat |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3900650 |
gcaaaaccaaagtgttatgttgctatttcatttcctcacttagagaatgtttgaccttttctgatttatatgagtcaatatctcatatcaaatatagtac |
3900551 |
T |
|
| Q |
210 |
tctttccatcccaaattaactgagccttttttgact |
245 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||| |
|
|
| T |
3900550 |
tctttccatcccaaattaactgagccattcttgact |
3900515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University