View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1068_low_16 (Length: 333)
Name: NF1068_low_16
Description: NF1068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1068_low_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 84 - 333
Target Start/End: Original strand, 36890631 - 36890864
Alignment:
| Q |
84 |
gcaatatattgttcttttacgcatatatcaagagaaaaacattgacataacaaatgtttttctatgactaattacacatgaattaatggaagatcataag |
183 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||| |
|
|
| T |
36890631 |
gcaatatattgttcttttacacatatatcaagagaaaaacattgacataacaaatgtttttctatgactaat-acacatg--------gaagat---aag |
36890718 |
T |
 |
| Q |
184 |
caggcaacaagctacaagctgcgctgctagcttttttggatgacacatatattt-acttctgnnnnnnnggtagaaacagatattgacatat--tgttct |
280 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||| ||| || |
|
|
| T |
36890719 |
caggcaacaagct-------gcgccgctagctttttcggatgacacatatattttacttctgttttttaggtagaaacagatattgacatatattgtgct |
36890811 |
T |
 |
| Q |
281 |
ataattggttatacatatgtgttatctgatgaaacagatttggctgtgatagt |
333 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36890812 |
ataattggttatacatatgtgttatgtgatgaaacagatttggctgtgatagt |
36890864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University