View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1068_low_17 (Length: 321)
Name: NF1068_low_17
Description: NF1068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1068_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 98 - 308
Target Start/End: Original strand, 41292015 - 41292225
Alignment:
| Q |
98 |
gaaagtggaccaccctatcatagcctggttgtgtggcacgttgttctagcatgaaacctgttcaaaaatgtgactcaaatgaaatcatgtctcagagttc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41292015 |
gaaagtggaccaccctatcatagcctggttgtgtggcacgttgttctaacatgaaacctgttcaaaaatgtgactcaaatgaaatcatgtctcagagttc |
41292114 |
T |
|
| Q |
198 |
aactgtgttctaactcgcgccagataaatcccccgccatttgtggagtctccaattgacttgacccctctatatatcccatggccgcaccttattgttat |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41292115 |
aactgtgttctaactcgcgccagataaatcccccgccatttgtggagtctccaattgacttgacccctctatatatcccatggccgcaccttattgttat |
41292214 |
T |
|
| Q |
298 |
tactttgcttc |
308 |
Q |
| |
|
||||||||||| |
|
|
| T |
41292215 |
tactttgcttc |
41292225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University