View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1068_low_20 (Length: 308)
Name: NF1068_low_20
Description: NF1068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1068_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 87 - 225
Target Start/End: Original strand, 10053980 - 10054118
Alignment:
| Q |
87 |
gtttccatcagaatctctcagcagctgctgtgactcatctcaaacccatctttgagaatggctggggttgggtagttcatccctaccctttaaaatgctt |
186 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10053980 |
gtttctatcagaatctctcagcagctgctgtgactcatctcaaacccatctttgagaagggctggggttgggtagttcatccctaccctttaaaatgctt |
10054079 |
T |
 |
| Q |
187 |
attgacatttttatacaagacttagttctttcaattgaa |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10054080 |
tatgacatttttatacaagacttagttctttcaattgaa |
10054118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University