View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1068_low_25 (Length: 251)
Name: NF1068_low_25
Description: NF1068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1068_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 6232674 - 6232437
Alignment:
| Q |
1 |
cgaattggggttggagaagaattgccaaagattccagacgaattatcacaagaaggaaaagattttctagaaaagtgtttcattaaggatcctttgagaa |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6232674 |
cgaattggtgttggagaagaattgccaaaaattccagaggaattatcacaagaaggaaaagattttttagaaaagtgtttcattaaggatcctttgagaa |
6232575 |
T |
 |
| Q |
101 |
gatggacagcagatatgctcttcaaacatccgtttatctccgatgttgaaactgtttcagttgtaaatgagttagttgatgagttgccattgtcttcacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6232574 |
gatggacagcagatatgctcttcaaacatccgtttatctccgatgttgaaactgtttcagttgtaaatgagttagttgatgagttgccattgtcttcacc |
6232475 |
T |
 |
| Q |
201 |
ttctccaaaaacttacttcaatatgctcattgtgtttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6232474 |
ttctccaaaaacttacttcaatatgctcattgtgtttc |
6232437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 30 - 194
Target Start/End: Complemental strand, 6221863 - 6221699
Alignment:
| Q |
30 |
gattccagacgaattatcacaagaaggaaaagattttctagaaaagtgtttcattaaggatcctttgagaagatggacagcagatatgctcttcaaacat |
129 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||| |||||||||||||| |||||||||| | ||||||||| ||||| ||||| || |||||| |
|
|
| T |
6221863 |
gattccagatgaattatcacaagtcggaaaagattttctcgaaaagtgtttcatcaaggatccttcaaaaagatggacggcagagatgcttttgaaacat |
6221764 |
T |
 |
| Q |
130 |
ccgtttatctccgatgttgaaactgtttcagttgtaaatgagttagttgatgagttgccattgtc |
194 |
Q |
| |
|
||||||||| | || ||||||||||||| | || || ||||| | |||||||||||||||| |
|
|
| T |
6221763 |
gagtttatctcaggtgatgaaactgtttcattggtgaaagagttgatcaatgagttgccattgtc |
6221699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University