View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1068_low_29 (Length: 209)
Name: NF1068_low_29
Description: NF1068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1068_low_29 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 7254024 - 7254216
Alignment:
| Q |
17 |
aatatattcaaaagacaattgtggttggagttttttcatggacaacaacttttcttgtaatgaggaaaatctttccaaaacgttcatttgatttctccaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7254024 |
aatatattcaaaagacaattgtggttggagttttttcatggacaacaacttttcttgtaatgaggaaaatctttccaaaacgttcatttgatttctccaa |
7254123 |
T |
|
| Q |
117 |
caggattgtctctacaattcatgcaattttagcagtaacattggctactctgtctgttcaaaattggaactgtccaatttgtcctgtggcctc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
7254124 |
caggattgtctctacaattcatgcaattttagcagtaacattggctactctgtctgttcaagattggaaatgtccaatttgtcctgtggcctc |
7254216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University