View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10690_high_1 (Length: 343)
Name: NF10690_high_1
Description: NF10690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10690_high_1 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 3e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 185 - 343
Target Start/End: Original strand, 6690517 - 6690681
Alignment:
| Q |
185 |
gattagattttgtaaagaaaaag-tgattagatggagaaa-ccagccttgggtgaggttaaatgtaatatagatgcagcgatttttaaggatcaaagctg |
282 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6690517 |
gattagattttgtaaaaaaaaaaatgattagacggagaaaaccagctttgcgtgaggttaaatgtaatatagatgcagcgatttttaaggatcaaaggtg |
6690616 |
T |
 |
| Q |
283 |
ctatatc----gtcgttatgtgcctaaggggaggaaacagtgagttcacagcagcaaaacacaac |
343 |
Q |
| |
|
||| ||| || ||||||||||||||||| ||||| |||||||||| |||||||||||||||| |
|
|
| T |
6690617 |
ctacatcgttggttgttatgtgcctaaggggtggaaagagtgagttcatagcagcaaaacacaac |
6690681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 27 - 99
Target Start/End: Original strand, 6689145 - 6689217
Alignment:
| Q |
27 |
tatggaacaatgttgatacacgacctgcattgacgattaggctagcgcgcaaatcactttaccaatggtagca |
99 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6689145 |
tatgaaacgatgttgatacacaacctgcattgacgattaggctggcgcgcaaatcactttaccaatggtagca |
6689217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 90 - 145
Target Start/End: Original strand, 6690423 - 6690477
Alignment:
| Q |
90 |
aatggtagcatgtgtgtttgaagcagctgacatatgattaatgttccaggctcggg |
145 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
6690423 |
aatggtagcatgtgtgtttgaagcagc-aacatatgagtaatgttccaggctcggg |
6690477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University