View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10691_high_10 (Length: 249)
Name: NF10691_high_10
Description: NF10691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10691_high_10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 74 - 249
Target Start/End: Complemental strand, 3364929 - 3364754
Alignment:
| Q |
74 |
gatagtggacatatcaatgacaattgttacaaattttatacacattattgatgccatttggagatattaaaatgaataaaactgaattattgcaaccaaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3364929 |
gatagtggacatatcaatgacaattgttacaaattttatacacattattgatgccatttggagatattaaaatgaataaaactgaattattgcaaccaaa |
3364830 |
T |
 |
| Q |
174 |
gcaactggtcatagacaaagaacattcttgcttgttgaaataaacttctgctggagttaaagaaaccaaaaacaac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3364829 |
gcaactggtcatagacaaagaacattcttgcttgttgaaataaacttctgctggagttaaagaaaccaaaaacaac |
3364754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University