View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10691_high_15 (Length: 217)
Name: NF10691_high_15
Description: NF10691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10691_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 88 - 204
Target Start/End: Original strand, 28232679 - 28232795
Alignment:
| Q |
88 |
tggagagccaagatcatcttacaccatcacacgtggatgcatctcgaccatcccttggtttccctttgggcactgcccttctcttgatcatcatttttag |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28232679 |
tggagagccaagatcatcttacaccatcacacgtggatgcatctcgaccatcccttggtttccctttgggcactgcccttctcttgatcatcatttttag |
28232778 |
T |
 |
| Q |
188 |
cttgagtggtatcctct |
204 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28232779 |
cttgagtggtatcctct |
28232795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 28232586 - 28232640
Alignment:
| Q |
1 |
cccttcttttccttcttagtgttcctcaaacacatgagtgtaagaggagctagag |
55 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28232586 |
cccttcttttccttctttgtgttcctcaaacacatgagtgtaagaggagctagag |
28232640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University