View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10691_high_4 (Length: 288)

Name: NF10691_high_4

Description: NF10691

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF10691_high_4

[»] chr2 (2 HSPs)

Target: chr2 (Bit Score: 62; Significance: 8e-27; HSPs: 2)

Name: chr2

Description:

Target: chr2; HSP #1

Raw Score: 62; E-Value: 8e-27

Query Start/End: Original strand, 198 - 279

Target Start/End: Complemental strand, 12767963 - 12767882

Alignment:

Q	198	tggtcaccgtcattgtcgatgaccaaatagacattctttgaggttgatgttgccttctcaaaccctttcgggtaggttcatc	279	Q
		\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	12767963	tggtcaccgtcgttgtcgacgaccaaataggccttctttgaggtcgatgttgccttctcaaaccctttcgggtaggttcatc	12767882	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2

Raw Score: 36; E-Value: 0.00000000003

Query Start/End: Original strand, 21 - 128

Target Start/End: Complemental strand, 12768084 - 12767977

Alignment:

Q	21	ccgccacgttgaggggtttggtttctttttagattgatatgcttgctggnnnnnnnnctcgacatttagattgaagatggatttgtatctcagatccaca	120	Q
		\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\| \|\|\|\|\|\|\| \|\|\| \| \|\|\| \| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	12768084	ccgccacgttgatgggtttggtttctttgtagatcgatccatttgctgggttttttgctcaaaattcatattgaagatggatttgtatctcagatccaca	12767985	T

Q	121	aggttgtc	128	Q
		\|\|\|\|\|\|\|
T	12767984	tggttgtc	12767977	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]