View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10691_high_6 (Length: 269)
Name: NF10691_high_6
Description: NF10691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10691_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 5 - 251
Target Start/End: Complemental strand, 4769956 - 4769710
Alignment:
| Q |
5 |
aataactacacctaattctccgtcatcaccactgtcaccatcgccggcgagattcctccgatatggatctatacaatatcggttggattttaagctctgt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4769956 |
aataactacacctaattctccgtcatcaccactgtcaccatcgccggcgagattcctccgatatggatctatacaatatcggttggattttaagctctgt |
4769857 |
T |
 |
| Q |
105 |
tttgagtctatttgcgttatacaatttgattttcaccgggaagaagaattatgatgtgaatgagaaggtaaatcagcgtgaggatagcgtgacgagtact |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4769856 |
tttgagtctatttgcgttatacaatttgattttcgccgggaagaagaattatgatgtgaatgagaaggtaaatcagcgtgaggatagcgtgacgagtact |
4769757 |
T |
 |
| Q |
205 |
gatgccggtgaaattaaatcggagaaacttaacggtgatgctgatgt |
251 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4769756 |
gatgccggtgaaattaaatcggacaaacttaacggtgatgctgatgt |
4769710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University