View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10691_high_8 (Length: 255)
Name: NF10691_high_8
Description: NF10691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10691_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 25702331 - 25702086
Alignment:
| Q |
1 |
cttgggattccacataaaacgtcttccaactccaagtcaaagttctaaaaaacattatgttaacgtcaaaatagctgcaaaattggttttaattcgtttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
25702331 |
cttgggattccacataaaacgtcttccaactccaagtcaaagttctaaaaa-cattatgttaacgtcaaaatagctgcaaaattggttataatttgtttc |
25702233 |
T |
 |
| Q |
101 |
cgttttaaca------acaaaacaacggcgacaaaaagttgttacacaccgaaatgcccttccacctatgacaaaatgcgtttcctaaacaaaaagagca |
194 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25702232 |
cgttttaacagagtaaacaaaacaacggcgacaaaaagttgttacacaccgaaatgcccttccgcctatgacaaaatgcgtttcctaaacaaaaagagca |
25702133 |
T |
 |
| Q |
195 |
agaatttatggataaaataaattttttactaaccttatctctctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25702132 |
agaatttatggataaaataaattttttactaaccttatctctctctg |
25702086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University