View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10691_low_22 (Length: 242)
Name: NF10691_low_22
Description: NF10691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10691_low_22 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 25702740 - 25702518
Alignment:
| Q |
20 |
acattggtccaaagcatctaattatagcaaattttcttcaaatagaactatccatactttctgtcagtgatattattctgaatcctctcttattagtatt |
119 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25702740 |
acattggtccaaagcacctagttatagcaaattttctacaaatagaactatccatactttctgtcagtgatattattctgaatcctctcttattagtatt |
25702641 |
T |
 |
| Q |
120 |
atcatttcagcaaaaaatgatgttagnnnnnnngtttgtctttaactgtctagaccagaatccaattccataaagtattacaaactatgtaatactgaca |
219 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25702640 |
ctcatttcagcaaaaaatgatgtaattttttttgtttgtctttaactgtctagaccagaatccaattccataaagtattacaaactatgtaatactgaca |
25702541 |
T |
 |
| Q |
220 |
cggttctgatagaaagcttgtcc |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25702540 |
cggttctgatagaaagcttgtcc |
25702518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University