View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10691_low_8 (Length: 288)
Name: NF10691_low_8
Description: NF10691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10691_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 8e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 198 - 279
Target Start/End: Complemental strand, 12767963 - 12767882
Alignment:
| Q |
198 |
tggtcaccgtcattgtcgatgaccaaatagacattctttgaggttgatgttgccttctcaaaccctttcgggtaggttcatc |
279 |
Q |
| |
|
||||||||||| ||||||| |||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12767963 |
tggtcaccgtcgttgtcgacgaccaaataggccttctttgaggtcgatgttgccttctcaaaccctttcgggtaggttcatc |
12767882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 128
Target Start/End: Complemental strand, 12768084 - 12767977
Alignment:
| Q |
21 |
ccgccacgttgaggggtttggtttctttttagattgatatgcttgctggnnnnnnnnctcgacatttagattgaagatggatttgtatctcagatccaca |
120 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| ||| ||||||| ||| | ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
12768084 |
ccgccacgttgatgggtttggtttctttgtagatcgatccatttgctgggttttttgctcaaaattcatattgaagatggatttgtatctcagatccaca |
12767985 |
T |
 |
| Q |
121 |
aggttgtc |
128 |
Q |
| |
|
||||||| |
|
|
| T |
12767984 |
tggttgtc |
12767977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University