View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10694_high_3 (Length: 231)
Name: NF10694_high_3
Description: NF10694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10694_high_3 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 45174773 - 45175003
Alignment:
| Q |
1 |
catagatcaggagcacggtaccacctagttgcaacatagtccttggtaaaagtaggtaaattaagtcagcaagcggtttagagaggtagctagattgcaa |
100 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45174773 |
catagttcaggtgcacggtaccacctagttgcaacatagtccttggtaaaagtaggtaaattaagtcagcaagcggtttagagaggtagctagattgcaa |
45174872 |
T |
|
| Q |
101 |
tttgtaggttccaactgaaaatcttaaaaaggcaaaacataattgattgatgaaatggatgaacatagttgcataacagagcacttacggtccagaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45174873 |
tttgtaggttccaactgaaaatcttaaaaaggaaaaacataattgattgatgaaatggatgaacatagttgcataacagagtacttacggtccagaaaat |
45174972 |
T |
|
| Q |
201 |
agtggatggagcatcattaaatgaaactcga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45174973 |
agtggatggagcatcattaaatgaaactcga |
45175003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 155
Target Start/End: Original strand, 45181754 - 45181809
Alignment:
| Q |
99 |
aatttgtaggttccaactgaaaatcttaaaaaggcaaaacataattgattgatgaaa |
155 |
Q |
| |
|
|||||||| |||||| ||||||||||| ||||||||||||||||||| || |||||| |
|
|
| T |
45181754 |
aatttgtacgttccatctgaaaatctt-aaaaggcaaaacataattgtttaatgaaa |
45181809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 73
Target Start/End: Complemental strand, 30054418 - 30054366
Alignment:
| Q |
21 |
ccacctagttgcaacatagtccttggtaaaagtaggtaaattaagtcagcaag |
73 |
Q |
| |
|
||||| ||||||||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30054418 |
ccaccaagttgcaacctagtccttggtataagtaggtaaaataagtcagcaag |
30054366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University